Labshake search
Citations for New England Biolabs :
7401 - 7450 of 9501 citations for FabFc ZAP rat Antibody Internalization Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... and linearized by the appropriate Type IIS enzyme (BspQI or BsmBI) and purified by Monarch RNA Cleanup kit (New England Biolabs) prior to IVT reactions.
-
bioRxiv - Biophysics 2023Quote: ... by site-directed mutagenesis of the HT-rad21 and HT-CTCF plasmids using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs) according to the manufacturer’s protocol with primers given in Supplementary Table 18 ...
-
bioRxiv - Bioengineering 2023Quote: ... The IVT reaction product was treated with DNase I to remove the DNA template and then purified using the Monarch RNA clean-up kit (NEB). dgRNA concentration was measured using a NanoDrop.
-
bioRxiv - Cancer Biology 2023Quote: ... NGS libraries were prepared from 30ng of the PCR product using the NEBnext Ultra II DNA library preparation kit for Illumina (New England Biolabs) according to manufacturer’s recommendations and using NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cDNA libraries were prepared from prepared RNA by Novogene using a Next® UltraTM RNA Library Preparation Kit (NEB) and sequenced using a NovaSeq 6000 platform (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: The pGEMT-KILR construct was linearized with NotI then in vitro transcribed using the HiScribe T7 Quick High Yield RNA synthesis kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... was used in sequential reverse transcription and PCR amplification steps using the Protoscript II first strand cDNA synthesis kit and Q5 Hi-fidelity DNA polymerase (NEB) according to manufacturer’s protocols ...
-
bioRxiv - Systems Biology 2023Quote: ... RT-qPCR quantification was carried out on 20 ng of RNA with the Luna One-Step RT-qPCR Kit (NEB). All qPCRs were performed in technical triplicates ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA-seq libraries were prepared with NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, E7765) and their quality was assessed on Bioanalyzer using High Sensitivity DNA assay (Agilent) ...
-
bioRxiv - Cell Biology 2023Quote: ... and GPNMB-EGFP-C425S constructs were generated by site-directed mutagenesis using a Q5 Site-Directed Mutagenesis Kit (#E0552S, New England Biolabs). All plasmids were sequenced to verify successful modification ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB, Ipswich, MA, USA). The sequencing libraries were validated on the Agilent TapeStation (Agilent Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... Viral RNA quantification was performed by RT-qPCR using the IP4 set of primers and probe and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
bioRxiv - Bioengineering 2023Quote: ... The IVT reaction product was treated with DNase I to remove DNA template and then purified using the Monarch RNA clean-up kit (NEB). RNA concentration was measured using a NanoDrop (ThermoFisher).
-
bioRxiv - Bioengineering 2023Quote: ... The sequencing library was generated using NEBNext® UltraTM II DNA Library Prep Kit (New England Biolabs, MA, United States) and sequenced on an Illumina Nova6000 platform generating 250-bp paired-end reads (Guangdong Magigene Biotechnology Co. ...
-
bioRxiv - Molecular Biology 2023Quote: ... by replacing the green fluorescent protein (GFP) with a mCherry reporter using the NEBuilding HiFi DNA Assembly Cloning Kit (New England Biolabs) (Ran et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA sequencing libraries were prepared with the NEBNext Ultra II DNA library prep kit according to the manufacturer’s instructions (New England Biolabs, E7645S) and sequenced on the Illumina NextSeq platform with the 75-cycle paired end kit (NextSeq 500/550 High Output Kit).
-
bioRxiv - Systems Biology 2023Quote: ... the sequencing library was generated with the NEBNext® Ultra™II Directional RNA Library Prep Kit (New England Biolabs) and paired-end sequencing was processed with the NovaSeq 6000 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR amplification of transposon-genome junctions was performed using the cycling parameters described in the kit for 11 cycles with Q5 Ultra II FS Master Mix (NEB) using primers YL006 (AGCGGCAATTTCACACAGGA ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was extracted from 5-10 µl of the cell scrape and prepared for sequencing using the NEBNext Ultra II FS DNA Library Prep Kit (NEB) with the following modifications ...
-
bioRxiv - Plant Biology 2023Quote: The EYFP reporter constructs for nuclear localization were created by bridging the linearized proGL2:EYFP SR54 binary vector lacking the GL2 cDNA with ssDNA oligos using the NEBuilder HiFi DNA Assembly Kit (New England Biolabs) and oligonucleotides given in Supplemental Table S3 ...
-
bioRxiv - Plant Biology 2023Quote: circRNAs were produced by in-vitro transcription from annealed DNA oligonucleotide templates (Table S2) using HighScribe T7 high-yield RNA synthesis kit (NEB) along with ATP ...
-
bioRxiv - Plant Biology 2023Quote: ... followed by first-strand cDNA synthesis with the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs) and NEBNext Multiplex Oligo for Illumina (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... brucei BFs CN PIP5Pase exclusively expressing V5-tagged PIP5Pase WT or mutant D360A/N362A for 24 h using the magnetic mRNA isolation kit (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The catalytic residue H528 of esaD was mutated to encode an alanine using a Q5 site-directed mutagenesis kit (NEB). esxCBED amplified from COL genomic DNA was then inserted upstream of esaD by HiFi assembly ...
-
bioRxiv - Biophysics 2023Quote: ... The TRAK1 construct was made through assembling His-ZZ-TEV-SNAP tag and TRAK1(1-395) into a pACEBac1 vector via HIFI DNA assembly kit (NEB). All constructs were verified using whole plasmid sequencing from Plasmidsaurus.
-
bioRxiv - Microbiology 2023Quote: ... cDNA libraries were prepared using a NEBNext Ultra II Directional RNA Library Prep Kit with rRNA Depletion (New England Biolabs) and sequenced using an Illumina NovaSeq 6000 with 150×150 cycle paired end sequence run ...
-
bioRxiv - Microbiology 2023Quote: ... Approximately 100 ng of total RNA was used in the detection and quantification of TgCPDH transcripts using the Luna Universal One-Step RT-PCR kit (NEB). Data acquisition was collected using the BioRad CFX96 Touch Real-Time PCR detection system ...
-
bioRxiv - Microbiology 2023Quote: ... which was created by substituting the codon encoding cysteine at amino acid residue position 2 on HypC with a codon decoding as alanine using site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit, New England Biolabs) employing the oligonucleotides HypCfwd (5’-TATACATATGGCGATAGGCGTTCCCGG-3’ ...
-
bioRxiv - Genomics 2023Quote: ... Library preparation was performed using the NEBNext Ultra II Directional RNA Library Prep Kit (New England BioLabs Inc. MA, USA) for strand-specific Illumina libraries ...
-
bioRxiv - Microbiology 2023Quote: ... MARCH2 chimeras containing the TM domains from either human MARCH4 or human transferrin receptor (TR) were generated using the NEBuilder HiFi DNA assembly kit (New England Biolabs) and the primers listed in Supplemental Table S2 ...
-
bioRxiv - Cell Biology 2023Quote: ... FLAG-tagged transgenes of AMOTL2 and HA-tagged MAGI-1 WW domains were obtained from Integrated DNA Technologies as gBlock HiFi Gene Fragments and cloned into the pCMV6 backbone via Gibson assembly using a HiFi DNA Assembly Cloning Kit (NEB).
-
bioRxiv - Cancer Biology 2023Quote: ... and RNA-seq libraries were prepared using a NEB-Next Ultra II Directional Library Prep Kit for Illumina (E7760, NEB). Library sizes were determined on a Bioanalyzer ...
-
bioRxiv - Systems Biology 2023Quote: ... and total RNA libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs), using 700ng of RNA per sample ...
-
bioRxiv - Biochemistry 2023Quote: ... and cloned into BamHI- and XhoI-digested pcDNA5/FRT vector using the NEBuilder HiFi DNA Assembly kit (New England Biolabs). The resultant construct ...
-
bioRxiv - Developmental Biology 2024Quote: ... Barcoded libraries were made with NEBNext Ultra II DNA Library Prep Kit for Illumina) using NEBNext Multiplex Oligos Dual Index Primers for Illumina (New England BioLabs) and sequenced on NextSeq2K (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were run on a 1% agarose gel and DNA was extracted using Monarch DNA Gel Extraction Kit (New England Biolabs). DNA was sequenced by Sanger sequencing using either the forward or reverse primer ...
-
bioRxiv - Systems Biology 2023Quote: ... Whole metagenome sequencing libraries were prepared from 26 µL of DNA solution using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs). The DNA was purified and size selected to remove excess adaptors and adaptor dimers using Ampure XP beads (Beckman Coulter Life Sciences) ...
-
bioRxiv - Plant Biology 2023Quote: ... EM-seq libraries were prepared from sheared DNA using an enzymatic methyl-seq kit following the standard instructions (New England BioLabs), and were subjected to NextSeq550 using 75bp paired-end sequencing ...
-
bioRxiv - Biophysics 2023Quote: ... all KIF5B mutations and truncations were made through substitution with gene fragments from IDT via HIFI DNA assembly kit (NEB) in a KIF5B mammalian expression vector ...
-
bioRxiv - Biophysics 2023Quote: ... The full length KIF5B in pACEBac1 was replaced with a C-terminal TEV-Twin-Strep-tag via HIFI DNA assembly kit (NEB). The TRAK1 construct was made through assembling His-ZZ-TEV-SNAP tag and TRAK1(1-395 ...
-
bioRxiv - Genomics 2023Quote: End repair and adaptor ligation steps of library preparation were performed with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) at either the standard total reaction volume of the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... Live CD19+ B cells and CD4+PD1+CXCR5- Tph cells were purified by high-speed sorting (FACSAria II) and were directly processed using NEBNext Single Cell/Low Input RNA Library Prep Kit (New England Biolabs), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... mutations were created in the chromoshadow domain of HP1γ in pGEMT-KpnI-HP1γ using the Q5 site-directed mutagenesis kit (New England Biolabs) according to manufacturer’s instructions (Data S1) ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA of the best quality from three replicates of each experiment were used for preparation of cDNA libraries for NGS using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... A transcription reaction was then carried out on the purified and quantified dsDNA using the T7 HiScribe transcription kit (NEB). The T7 RNA Polymerase recognizes the T7 promoter region that seeds transcription of the adjacent 20-mer target sequence thus generating the targeting sgRNA for Cas9-mediated nicking of genomic DNA templates ...
-
bioRxiv - Physiology 2024Quote: ... followed by RNA purification using a Monarch RNA Cleanup Kit following the manufacturer’s protocol (New England Biolabs, Whitby, ON, Canada). One-day old male and female adult mosquitoes were briefly anesthetized using CO2 and injected in the thorax with 1 μg of AedaeItp ...
-
bioRxiv - Plant Biology 2024Quote: ... polyA-enriched RNASeq libraries were prepared using a PolyA selection NEBNext Ultra II RNA kit (New England BioLabs, Ipswich MA) and sequenced on the Illumina NovaSeq S4 sequencing platform (2×150 bp reads ...
-
bioRxiv - Plant Biology 2024Quote: ... with 2 µg of the freshly synthetized SgRNA1 obtained with the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB). DNA repair templates containing the fenhexamid resistance cassette surrounded by 60 bp of the target gene for HR were obtained by PCR ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries for sequencing were prepared using a NEBNext Ultra II FS DNA library prep kit for Illumina modules E7810L and E7595L (New England BioLabs) by the manufacturer’s protocol (DNA input ≥100 ng ...
-
bioRxiv - Plant Biology 2024Quote: ... Nucleotide changes leading to amino acid substitutions for Pic3 and Pic12 were first created in pENTR/D-TOPO (which contained wild-type Pic3 or Pic12) vectors by using the Q5 site-directed mutagenesis kit (New England Biolabs) with specific primers (Supplemental Table S4) ...