Labshake search
Citations for New England Biolabs :
7201 - 7250 of 9501 citations for FabFc ZAP rat Antibody Internalization Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... total RNA samples from lungs at 4 dpi were subjected to library preparation using NEBNext Ultra II Directional RNA Library prep kit for Illumina (New England Biolabs) and sequenced on an Illumina NovaSeq 6000 with 150 base pair-end reads at Azenta ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quality control and quantification of the resulting dual-indexed barcoded libraries was performed with Agilent TapeStation and by qPCR (NEBNext Library Quant Kit for Illumina, New England Biolabs).
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL lysate was used as a template for the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) on a Light Cycler 480 (Roche) ...
-
bioRxiv - Neuroscience 2023Quote: ... RNAseq libraries were generated by the Cornell TREx Facility using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) using 700ng input total RNA per sample ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... PCR-based mutagenesis was carried out using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs®, MA, USA) as per the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA (5ng) was used for sequencing library construction using NEBNext Ultra II DNA Library Prep Kit for Illumina (Cat # E7645, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... in combination with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina and NEBNext Multiplex Oligos for Illumina (Unique Dual Index Primer Pairs) (New England BioLabs). The resulting libraries were subjected to sequencing on a NextSeq 550 Sequencing System (Illumina ...
-
bioRxiv - Genetics 2023Quote: ... The genomic sequence CATGGTATAAAGTGAATCAAGG was targeted by the plasmid pDSP45 which was made from pDD162 (Dickinson et al., 2013) using the Q5 site-directed mutagenesis kit (NEB).
-
bioRxiv - Microbiology 2023Quote: ... and cloned into the vector pCE along with a 30 bp site specific spacer sequence (in the gene to be deleted) using Gibson assembly (Gibson Assembly Cloning Kit, New England Biolabs) using 1µg of fragments and plasmid at a 3:1 ratio then incubating at 50 °C for 4 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
bioRxiv - Plant Biology 2023Quote: ... To allow BiFC imaging of pSITE and pROK based sYFP tags the pSITE YFPc sequences were extended and pSITE YFPn sequences shortened accordingly using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) and the primers listed in Table S1.
-
bioRxiv - Plant Biology 2023Quote: ... A cDNA clone for the 2b protein of Ho-CMV was recapitulated by site-directed mutagenesis of the coding sequence of the Fny-CMV 2b protein using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The resultant DNA product encoding the recapitulated Ho-CMV 2b protein contained the amino acid substitutions S47A ...
-
bioRxiv - Systems Biology 2023Quote: ... the library pool ranging from 135 to 146 bp including the DNA marker were gel purified and quantified by NEBNext Library Quant kit (NEB) using QuantStudio 5 Real-Time PCR System (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: G4tr (UUAGGG)4 and G4mt (UUACCG)4 were prepared using an in vitro the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs) following the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Each fraction containing protein-bound RNA was purified and prepared for RNA-sequencing library using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). All the libraries were sequenced on a NextSeq 500 sequencer (Illumina) ...
-
bioRxiv - Systems Biology 2023Quote: ... Total RNA library preparation was done by introducing 500 ng total RNA into Illumina’s NEBNext Ultra II directional mRNA (UMI) kit (NEB, E7760S), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA samples were DNAse treated with the Turbo DNAse (Thermo-Fisher) followed by cleanup with the Monarch RNA Cleanup Kit (NEB). Reagents were used according to the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2023Quote: ... Point mutations were introduced in the N sequence by site-directed mutagenesis using the Q5 site-directed mutagenesis Kit (New England Biolabs). Sequence analysis was carried out to check the integrity of all constructs ...
-
bioRxiv - Biochemistry 2023Quote: ... A TEV protease cut site preceding the 6x histidine tag was previously introduced using the Q5 Site-Directed Mutagenesis Kit from NEB and the GeneJET Plasmid Miniprep Kit from ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... Library quality was assessed using an Agilent Tapestation 4200 instrument and quantity determined by qPCR using an NEBnext library quantification kit (NEB). Libraries were sequenced as described previously46 and reads are available from ArrayExpress using accession code E-MTAB-11906 ...
-
bioRxiv - Neuroscience 2023Quote: The EEF1A2 CDS was cloned into pcDNA3.1-FLAG (gift from Saunders Lab) using NEBuilder® HiFi DNA Assembly Cloning Kit (NEB) according to the protocol of the manufacturer ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mutagenesis of csn-5(D152N) was performed using a Q5 site-directed mutagenesis kit per manufacturer instructions (New England BioLabs). For transgenic lines used in PLA ...
-
bioRxiv - Pathology 2023Quote: ... cDNA library was generated from total mRNA (1 µg) using NEBNext UltraTM RNA Library Prep Kits for Illumina (New England BioLabs). cDNA libraries were sequenced by NovaSeq 6000 (Illumina ...
-
bioRxiv - Physiology 2023Quote: ... Single and double mutations targeting the candidate residues identified by computational modeling were generated by the Q5 Site-directed mutagenesis kit (New England BioLabs). More complex compound mutations were generated in synthetic gene fragments (TWIST Bioscience) ...
-
bioRxiv - Biochemistry 2023Quote: ... was prepared by in vitro transcription using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs Inc., Massachusetts, USA) with 1 unit RNase Inhibitor (New England Biolabs Inc. ...
-
bioRxiv - Cancer Biology 2023Quote: Libraries were prepared by the Van Andel Institute Genomics Core from an input of 41 ng to 51 ng of ChIP DNA (taken directly from DNA IP’d for siQ-ChIP-seq) using the NEBNext Enzymatic Methyl- seq Kit (New England Biolabs E7120L). The denaturation method used was 0.1 N sodium hydroxide ...
-
bioRxiv - Cell Biology 2023Quote: ... we generated CRISPR/Cas9 vectors by mutating the UPRT guide RNA sequence in the plasmid pSag1-Cas9-U6-sgUPRT [33] to a guide RNA sequence of the target gene by using Q5 Site-Directed Mutagenesis Kit (NEB). The CRISPR/Cas9 plasmid and the PCR amplicon were transfected into corresponding parental parasites by using the Lonza Nucleofector and Manufacture suggested protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... Site-specific mutagenesis of double-stranded plasmid DNAs were constructed using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England Biolabs), according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2023Quote: ... coding exons of Gdf1/3 were individually amplified from genomic DNA templates and then assembled into the pXT7 vector using a Gibson cloning kit (New England Biolabs). Nodal ...
-
bioRxiv - Developmental Biology 2023Quote: ... MYC) were made in-house by in vitro transcription using mRNA synthesis with HiScribeTM T7 ARCA mRNA Kit (NEB E2060S) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Biochemistry 2023Quote: Library preparation was performed with 5 µL of twice poly(A)-enriched sample using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England BioLabs) according to manufacturer’s instructions for “Protocol for use with Purified mRNA or rRNA Depleted RNA” ...
-
bioRxiv - Biophysics 2023Quote: ... and ΔpreNAC (a.a. 1−36+61−140)) were introduced using the Site-Directed Mutagenesis kit (New England Biolabs, MA, USA). The complete sequences of all recombinant protein constructs used in this study are listed in the Supplementary Information (“Protein construction and sequence” section) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The eluted DNA fragments were then amplified by PCR with Nextera compatible indexed sequencing i5 and i7 adapters using NEBNext 2x PCR Master Mix PCR kit (M0541, NEB). The amplified DNA library was fragment size selected from 200bp to 800bp using Ampure XP beads (A63880 ...
-
bioRxiv - Genetics 2023Quote: ... RT-qPCR was performed on 10 ng total RNA using the Luna Universal One-Step RT-qPCR Kit (NEB, E3005L). bin3 ...
-
bioRxiv - Genetics 2023Quote: ... libraries were generated using total RNA from single and pooled mites (100-600 ng) with the NEBNext Multiplex Small RNA Library Prep kit (NEB) following the manufacturers protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA libraries were generated using NEBNext® Ultra™ II Directional (stranded) RNA Library Prep Kit for Illumina (NEB #E7760L). Ribosomal RNA was removed using NEBNext rRNA Depletion Kit (human ...
-
bioRxiv - Molecular Biology 2023Quote: ... Second-strand DNA synthesis was done by ligating 10 µM of a blunt-end duplex comprised of a 32-bp Illumina R1-3’SpC3 and 5’-phosphorylated R1R-3’SpC3 DNA (pre-annealed by incubating at 95°C for 3 min and slowly cooling to 25°C) using a Quick ligase kit (New England Biolabs) according to manufacturer’s protocol followed by clean-up as described above ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries for small DNA fragments (25-75 bp) were prepared with NEBNext Ultra II DNA library prep Kit (NEB#E7645).
-
bioRxiv - Neuroscience 2023Quote: ... and used as the template to insert the Glu-Glu epitope sequence (EYMPME) and the GPR37L1 variants used in the experiments by in vitro mutagenesis using Q5 Site-Directed Mutagenesis Kit (BioLabs). cDNA clones were confirmed by Sanger DNA sequencing (GeneWiz) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng of purified DNA was then used for library preparation with NEB Next Ultra Library Preparation Kit (New England Biolabs), using five PCR cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... In vitro Cas9 incubation was performed to enrich the nanopore library for regions of interest using EnGen sgRNA synthesis kit (NEB) and Cas9 nuclease (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA from the whole nuclei or nuclear condensate fractions were extracted using genomic DNA extraction kit (New England Biolabs). DNA-seq library was prepared from 50 ng of extracted genomic DNA using Illumina Nextera DNA Library Prep kit ...
-
bioRxiv - Microbiology 2023Quote: ... DNA libraries were prepared from extracted gDNA using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB). DNA was purified and size selected using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2023Quote: ... Then the enriched mRNA was sheared into short fragments using fragmentation buffer and reversely transcribed into cDNA by Next Ultra RNA Library Prep Kit for Illumina (NEB #7530 ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... RNA-Seq libraries were then prepared using the NEBNext® Ultra ™ II Directional RNA Library Prep Kit (NEB, E7760) total RNA with rRNA depletion protocol using 100 ng of input RNA ...
-
bioRxiv - Genetics 2023Quote: The site directed mutagenesis of the rbsD gene to introduce the stop codon and the mutated dsrA binding sites was carried out using the Q5 mutagenesis kit (New England Biolabs) and selection on kanamycin plates ...
-
bioRxiv - Genomics 2023Quote: ... Short read Illumina sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit for Illumina (New England Biolabs), and sequenced on an Illumina HiSeq 2500 ...
-
bioRxiv - Immunology 2023Quote: ... were purified using the QIAquick PCR purification kit and ligated into the appropriate linearized expression vectors using T4 DNA ligase (New England BioLabs) and incubated overnight at 16°C.
-
bioRxiv - Genomics 2023Quote: Small RNA libraries were prepared using the NEBnext small RNA library kit for Illumina (New England Biolabs, Cat. No E7330S), following the standard protocol with the following parameters ...