Labshake search
Citations for New England Biolabs :
7101 - 7150 of 10000+ citations for Human Oxidized low density lipoprotein receptor 1 OLR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Following amplification using Cell3™ Target: DNA Target Enrichment kit and NEBNext® Q5U® Master Mix (NEB, # M0597), DNA quality and quantity were measured using TapeStation 4200 system ...
-
bioRxiv - Biochemistry 2022Quote: ... the indicated deletion and addition mutations were introduced by QuickChange site-directed mutagenesis (NEB, Q5 Site-Directed Mutagenesis Kit). For TatA variants in pBAD33 (a vector with arabinose-inducible araBAD operon ...
-
bioRxiv - Molecular Biology 2022Quote: The strand-specific RNA sequencing library was prepared by using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina following the manufacturer’s instructions (NEB). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries for next-generation sequencing were prepared using the NEBNext Ultra DNA Library Kit for Illumina according to the manufacturer’s protocol (New England Biolabs), and subjected to sequencing on Illumina Novaseq 6000 using PE150 ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by library preparation using NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NEB E7760). Quantification of the libraries was done by Qubit and TapeStation ...
-
bioRxiv - Microbiology 2022Quote: ... while Gluc and Cluc expression levels were determined using Biolux Gaussia or Cypridina luciferase assay kits (New England BioLabs) and a microplate reader ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA libraries were prepared using the the NEBNext® Ultra™ DNA Prep Kit (New England BioLabs® Inc.) according to the manufacturer’s protocols ...
-
bioRxiv - Genomics 2022Quote: ... 10 ng DNA was used to prepare sequencing libraries with the Ultra II DNA Library Prep kit (NEB #E7645S).
-
bioRxiv - Plant Biology 2022Quote: ... Libraries were prepared according to the manufacturer’s protocol in NEBNext Ultra II Directional RNA Library Prep Kit (New England BioLabs) and individually indexed with NEBNext Multiplex Oligos for Illumina (New England BioLabs) ...
-
bioRxiv - Physiology 2022Quote: cDNA libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). 150bp reads of the cDNA libraries were generated on a NovaSeq SP (Illumina ...
-
bioRxiv - Molecular Biology 2022Quote: RNA-seq libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB E7760S), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Strand-specific reverse transcription was performed using 1 μg of RNA and strand-specific oligonucleotides (0.1 μM each) with the ProtoScript First Strand cDNA Synthesis Kit (New England Biolabs) supplemented with actinomycin D (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... we quantified the libraries using the NEBNext® Library Quant Kit for Illumina (New England Biolabs, Ipswich, MA, USA), size-correcting for the average length reported in the Bioanalyzer report considering a 400-700 bp quantification window ...
-
bioRxiv - Biochemistry 2022Quote: ... The mRNA was prepared in vitro by using the HiScribeTM T7 high–yield RNA synthesis kit (New England Biolabs) and purified using an RNeasy MinElute Cleanup kit (QIAGEN) ...
-
bioRxiv - Microbiology 2022Quote: RNA sequencing libraries were prepared using the NEBNext Ultra II RNA library prep kit for Illumina according to the manufacturer’s instructions (NEB). Prior to library prep ...
-
bioRxiv - Biochemistry 2022Quote: ... Mutants were created via side directed mutagenesis using primers designed on NEBaseChanger and Q5 site-directed mutagenesis kit following manufacturer’s directions (New England BioLabs). BL21(DE3 ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs, E7645S) with manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Libraries were prepared according to the manufacturer’s protocol in NEBNext Ultra II Directional RNA Library Prep Kit (New England BioLabs) and individually indexed with NEBNext Multiplex Oligos for Illumina (New England BioLabs) ...
-
bioRxiv - Developmental Biology 2022Quote: ... truSeq-barcoded RNAseq libraries were generated with the Ultra II RNA Library Prep Kit (non-directional) (New England Biolabs). Each library was quantified with a Qubit 2.0 (dsDNA HS kit ...
-
bioRxiv - Cell Biology 2022Quote: ... The fragments were assembled together with the SmaI-digested pBIG4MRH vector using the NEBuilder HiFi DNA Cloning kit according to the manufacturer’s instructions (New England Biolabs). The primers used are summarized in Table S7 ...
-
bioRxiv - Developmental Biology 2022Quote: ... In vitro transcription of gRNA was performed using the T7 High Yield RNA Synthesis Kit (New England Biolabs, E2040S) and generated gRNA was purified ...
-
bioRxiv - Genetics 2022Quote: ... The swab was then given to the primary investigator and placed in a 1.5 ml microcentrifuge tube containing 400 μl of Cell Lysis Buffer from the Monarch Genomic DNA Purification Kit (NEB). Samples were stored in Cell Lysis Buffer at 4°C until processed.
-
bioRxiv - Cancer Biology 2022Quote: ChIP sequencing libraries were prepared using NEBNext® Ultra™ II DNA Library Prep Kit reagents (NEB, Ipswitch, MA) according to the procedure recommended by the manufacturer ...
-
bioRxiv - Neuroscience 2022Quote: ... Cas9 mRNA and sgRNAs were synthetized and purified by HiScribe™ T7 High Yield RNA Synthesis Kit (E2040S, NEB) and Purification of Synthesized RNA (E2040 ...
-
bioRxiv - Microbiology 2022Quote: ... Sequencing libraries for salivary samples were prepared using the NEBNext Ultra DNA Library Prep kit (New England Biolabs, Ipswich) using a dual barcoding system ...
-
bioRxiv - Molecular Biology 2022Quote: ... The library preparation was done using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, E7760S). The libraries were multiplexed (six samples per lane ...
-
bioRxiv - Microbiology 2022Quote: ... and crRNAs that were synthesized commercially (IDT) or with the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB). dsDNA templates were amplified from plasmids and purified using DNA Clean and Concentrator Kit (Zymo) ...
-
bioRxiv - Cancer Biology 2022Quote: ... We cleaned the samples and inputs using the Monarch PCR & DNA clean-up kit (New England BioLabs, Ipswich, MA), prepared libraries using the ThruPLEX DNA-seq Kit (Rubicon Genomics ...
-
bioRxiv - Neuroscience 2022Quote: Libraries were prepared from 90-ng of RNA from each sample using the NEBNext Ultra kit (New England BioLabs). Samples were sequenced on an Illumina HiSeq 4000 with a 75 bp paired-end read ...
-
bioRxiv - Genetics 2022Quote: ... and cloning into YEp352 linearized with EcoRI/HindIII using the NEBuilder Hifi DNA assembly cloning kit (New England BioLabs). All clones generated were sequenced to ensure that all cloned wildtype S ...
-
bioRxiv - Developmental Biology 2022Quote: ... Total RNA-seq libraries were prepared using Total RNA-seq ScriptSeq Library Prep Kit for Illumina (New England Biolabs) and sequenced using the HiSeq 50 cycle single-end reads protocol on the HiSeq 2500 system ...
-
bioRxiv - Cell Biology 2022Quote: ... All plasmids used in this study were constructed using either Q5 Site Directed Mutagenesis Kit (New England Biolabs, E0554S) or In-Fusion HD Cloning Plus (Clonetech ...
-
bioRxiv - Cell Biology 2022Quote: ... while the TRIM25-PTAA mutant was generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA), by performing sequential mutagenesis reactions to individually mutate each residue to alanine ...
-
bioRxiv - Cell Biology 2022Quote: ... for 2 hours at 37°C and purified using Monarch® DNA Gel Extraction Kit (T1020S, New England Biolabs) before digestion-ligation with the gRNA-pScaffold-H1 using FastDigest Esp3I and T7 Ligase (M0318L ...
-
bioRxiv - Microbiology 2020Quote: Mutations within the stem-loop binding site of SHOxi were constructed using the Q5 Site-directed Mutagenesis kit (NEB) standard protocol on the previously described SHOxi overexpression construct (in pTA1300) ...
-
bioRxiv - Microbiology 2020Quote: ... was isolated via ammonium acetate salt precipitation if greater than 1.5 × 106 cells were recovered or using the Monarch Genomic DNA Purification kit (NEB) if fewer per the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mutated forms of MLS_mStat3_NES mRNA were obtained from pCS2+MLS_mStat3_NES by site-directed mutagenesis using the Q5® Site-Directed Mutagenesis Kit (NEB); primers are indicated in Table 2.
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was then performed in 384 well format with Luna Universal Probe One-Step RT-qPCR Kit (NEB), assaying Fluc (primers oHR711/712 ...
-
bioRxiv - Microbiology 2020Quote: RNA sequencing libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (New England BioLabs; Ispawich, USA) and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Cancer Biology 2020Quote: ... 500ng of total RNA was ribosomal RNA (rRNA) depleted using a NEBNext rRNA Depletion Kit (New England BioLabs, E6310L). First strand cDNA was generated using a Maxima H minus First Strand cDNA Synthesis Kit (Thermo Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... was cloned into phCMV3 vector by assembling two CDS fragments amplified from phCMV3-CatSpertS:WT (phCMV3-CatSpertS:Mut) using NEBuilder® HiFi DNA Assembly Kit (NEB). ORF sequences of CatSperτS:WT (phCMV3-CatSpertS:WT ...
-
bioRxiv - Evolutionary Biology 2021Quote: Sequencing libraries were prepared from 1µg RNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Incubation time for fragmentation of total RNA was 6 mins and no size selection was performed ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were generated using NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... Preparation of genomic DNA libraries was carried out using the NEBNext Ultra II FS DNA Library Prep Kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Libraries for sequencing were prepared using NEBNext Ultra II DNA library prep kit for Illumina (New England Biolabs, E7465). Libraries were sequenced on an Illumina HiSeq 1500 instrument at the Laboratory of Functional Genomic Analysis (LAFUGA ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Strand-specific libraries were prepared with the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs). Indexed ...
-
bioRxiv - Cancer Biology 2021Quote: ... the purification of PolyA containing mRNA molecules using poly-T oligo attached magnetic beads from 1μg total RNA (with the Magnetic mRNA Isolation Kit from NEB), a fragmentation using divalent cations under elevated temperature to obtain approximately 300bp pieces ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA-seq libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB E7760S) with the NEBNext Poly(A ...
-
bioRxiv - Neuroscience 2021Quote: ... mutations were respectively inserted in the LEV-1 and UNC-29 subunits by PCR using the Q5 site-directed mutagenesis kit according to the manufacturer’s recommendations (New England Biolabs). The forward and reverse primers used were 5’- GTTCTTTGAGGCAACAGTTGG −3’ 5’- CCGTACAACAAAAACCGATCCA −3’ for G461E substitution in lev-1 cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries with single index were prepared using the NEBNext DNA library prep kit (New England BioLabs, Ipswich, MA) and then sequenced on the Illumina MiSeq sequencing platform (Illumina ...