Labshake search
Citations for New England Biolabs :
7051 - 7100 of 9547 citations for QuantiChrom Phosphate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... and cloned into the BsaI sites of pSGAb-km and pBECAb-apr using a Golden Gate Assembly Kit (New England Biolabs) to generate pSGAb_ataA and pBECAb_ataA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The resulting amplicons were assembled with SalI- and KpnI-cut pSGAb-ataA using the NEBuilder HiFi DNA assembly kit (New England Biolabs) to generate pSGAb-ataA_HR.
-
bioRxiv - Systems Biology 2024Quote: ... Libraries were generated from 1 μg DNA per sample using the NEBNext Ultra DNA Library Prep Kit (NEB #E7645, USA) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... polyA-enriched RNASeq libraries were prepared using a PolyA selection NEBNext Ultra II RNA kit (New England BioLabs, Ipswich MA) and sequenced on the Illumina NovaSeq S4 sequencing platform (2×150 bp reads ...
-
bioRxiv - Plant Biology 2024Quote: ... with 2 µg of the freshly synthetized SgRNA1 obtained with the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB). DNA repair templates containing the fenhexamid resistance cassette surrounded by 60 bp of the target gene for HR were obtained by PCR ...
-
bioRxiv - Plant Biology 2024Quote: ... Nucleotide changes leading to amino acid substitutions for Pic3 and Pic12 were first created in pENTR/D-TOPO (which contained wild-type Pic3 or Pic12) vectors by using the Q5 site-directed mutagenesis kit (New England Biolabs) with specific primers (Supplemental Table S4) ...
-
bioRxiv - Plant Biology 2024Quote: ... Amplification specificity was assessed by agarose gel electrophoresis and amplicons were subsequently purified with the Monarch PCR & DNA Clean Up Kit (NEB). Resulting DNA concentrations were spectrophotometrically measured by NanoDrop ...
-
bioRxiv - Immunology 2024Quote: ... Oxford Genomics Centre prepared bulk RNA libraries using an NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (New England Biolabs) and sequenced the samples at a depth of 25 million reads per sample on a NovaSeq6000 (Illumina) ...
-
bioRxiv - Neuroscience 2024Quote: ... using the NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Immunology 2024Quote: Poly A-enriched libraries were made using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB, cat. E7770) and sequenced on a NovaSeq SP with PE150 read length.
-
bioRxiv - Immunology 2024Quote: ... Libraries were prepared by the West Virginia University Genomics Core using the NEBNext Low Input/Single Cell RNA-Seq kit (New England Biolabs). Libraries were sequenced to 30 million reads on a Nextseq 2000 (Illumina ...
-
bioRxiv - Biochemistry 2024Quote: In vitro translation was monitored by the production of luciferase signal in a PURExpress in vitro protein synthesis kit (NEB), using firefly luciferase mRNA as an input ...
-
bioRxiv - Molecular Biology 2024Quote: ... The peptides obtained by trypsin digestion were subsequently labeled as directed by the tandem mass tag (TMT) kit (PTM Biolabs). The labeling peptides were then fractionated by high pH reverse-phase high-performance liquid chromatography and further subjected to liquid chromatography with tandem mass spectrometry (LC-MS/MS ...
-
bioRxiv - Cell Biology 2024Quote: ... The remaining steps of library preparation were done using and the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs). Adapters and PCR primers were purchased from New England BioLabs ...
-
bioRxiv - Cancer Biology 2024Quote: The purified DNA was fragmented using the Covaris M220 and the libraries were constructed using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs) for next generation sequencing ...
-
bioRxiv - Systems Biology 2024Quote: Approximately 100 ng of each RNA sample was used to create Illumina sequencing libraries using a NEBNext Ultra II Directional RNA Library Prep Kit for Illumina with NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... Approximately 100 ng of each DNA sample was used to create Illumina sequencing libraries using a NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs (NEB), E7805S) ...
-
bioRxiv - Systems Biology 2024Quote: 50 ng RNA of each sample were reverse transcribed and barcoded by using the PCR-cDNA barcoding kit (SQK-PCB111.24) and NEBNext Companion Module (NEB E7180L). Libraries were then sequenced on the Nanopore PromethION platform.
-
bioRxiv - Plant Biology 2024Quote: Whole Methylome Sequencing (WMS) was performed on genomic libraries prepared using the NEBNext Enzymatic Methyl-seq Kit (New England BioLabs) following the manufacturer instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... Sequence fragments of ATML1 (START1, START2, and didomain) were generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) with the following primers ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA libraries were produced using NEBNext Ultra II DNA Library Preparation kit and NEBNext Unique Dual Index Primers (New England Biolabs). Libraries were quality checked using Agilent D1000 TapeStation kit and Qubit Flourometer and then sequenced on the Illumina NovaSeq X (Admera Health ...
-
bioRxiv - Microbiology 2023Quote: ... The catalytic residue H528 of esaD was mutated to encode an alanine using a Q5 site-directed mutagenesis kit (NEB). esxCBED amplified from COL genomic DNA was then inserted upstream of esaD by HiFi assembly ...
-
bioRxiv - Genomics 2023Quote: End repair and adaptor ligation steps of library preparation were performed with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) at either the standard total reaction volume of the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA libraries were prepared using a NEBNext Ultra II Directional RNA Library Prep Kit with rRNA Depletion (New England Biolabs) and sequenced using an Illumina NovaSeq 6000 with 150×150 cycle paired end sequence run ...
-
bioRxiv - Microbiology 2023Quote: ... Approximately 100 ng of total RNA was used in the detection and quantification of TgCPDH transcripts using the Luna Universal One-Step RT-PCR kit (NEB). Data acquisition was collected using the BioRad CFX96 Touch Real-Time PCR detection system ...
-
bioRxiv - Microbiology 2023Quote: ... which was created by substituting the codon encoding cysteine at amino acid residue position 2 on HypC with a codon decoding as alanine using site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit, New England Biolabs) employing the oligonucleotides HypCfwd (5’-TATACATATGGCGATAGGCGTTCCCGG-3’ ...
-
bioRxiv - Microbiology 2023Quote: ... MARCH2 chimeras containing the TM domains from either human MARCH4 or human transferrin receptor (TR) were generated using the NEBuilder HiFi DNA assembly kit (New England Biolabs) and the primers listed in Supplemental Table S2 ...
-
bioRxiv - Physiology 2024Quote: ... followed by RNA purification using a Monarch RNA Cleanup Kit following the manufacturer’s protocol (New England Biolabs, Whitby, ON, Canada). One-day old male and female adult mosquitoes were briefly anesthetized using CO2 and injected in the thorax with 1 μg of AedaeItp ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries for sequencing were prepared using a NEBNext Ultra II FS DNA library prep kit for Illumina modules E7810L and E7595L (New England BioLabs) by the manufacturer’s protocol (DNA input ≥100 ng ...
-
bioRxiv - Biochemistry 2024Quote: ... reverse 5’-GTGGCC CTCGAG TCA GTG AGT TTC ATG TTG G-3’ and then purified using the Monarch PCR plus DNA purification kit (NEB). The purified PCR product was digested by KpnI and XhoI (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR was performed using primers containing the homology arm flanking the sgRNA region (replacing the BRD4 homology arm) and Gibson cloned (NEBuilder Hifi DNA assembly kit, NEB) into the same vector by digesting with MluI restriction enzyme.
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA libraries were constructed using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England BioLabs, #E7760) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The sequencing library was generated by combining equal amounts of purified PCR products and quantified using the NEBNext Library Quant Kit for Illumina (New England Biolabs). The primer 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGTGGAAAGGACGAAACACCG-3’ was used to sequence on Illumina platforms.
-
bioRxiv - Molecular Biology 2024Quote: ... The CHD4-GFP mutant was cloned with selective primers (fwd, 5’-GGATGCTACAGGTGGAACCCTGCACCCCTA-3’; rev, 5’-GCCCAGGCCCGACGCCAT-3’) and a Q5 site-directed mutagenesis kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries for DNA fragments were prepared based on the NEBNext Ultra II DNA library prep Kit for Illumina (NEB#E7645).
-
bioRxiv - Molecular Biology 2024Quote: ... 25ul ChIP DNA or 10ng Input DNA were used to generate libraries using the NEBNext Ultra II Library Prep Kit for Illumina (NEB). Reactions were scaled down to half otherwise processing was according to the manufacturer’s manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... The repair template was assembled and integrated into pCC1 using Gibson assembly (Gibson et al., 2008) (NEB Hifi assembly kit). Colony PCR was used to check the plasmids had the correct inserts (F-93/R-91 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA samples were subjected to DNase I treatment to avoid genomic DNA contamination using a DNase I kit [New England Biolabs (NEB), USA] following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 72mer Ψ-containing model RNA used for mutation analysis and the 1.8-kb 10% Ψ-modified RNA used for UHPLC-MS/MS were prepared by T7 in vitro transcription using HiScribe T7 High Yield RNA Synthesis Kit (NEB) and Pseudo-UTP (Jena Bioscience ...
-
bioRxiv - Genomics 2024Quote: ... and the library preparation was conducted using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Sequencing was performed on the NextSeq500 machine (Illumina) ...
-
bioRxiv - Molecular Biology 2024Quote: ... T7 promoter region was added to the 5’ end of each construct for in vitro transcription of RNA using T7 RNA polymerase from T7 HiScribe RNA synthesis kit (New England Biolabs). Synthesized RNA was subjected to DNase treatment (TURBODNase ...
-
bioRxiv - Molecular Biology 2024Quote: SINV was produced from pT7-SVwt plasmid90 that was first linearized with XhoI and purified to use it as a template for in vitro RNA transcription with HiScribe T7 ARCA mRNA kit (NEB). Transcribed viral RNA was transfected into BHK-21 using Lipofectamine 3000 reagent (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... The HIV-1AC-1 mutations were introduced into WT and N74D pNLdE-luc using the Gibson Assembly Cloning kit (New England Biolabs) and primers shown in Table S1 ...
-
bioRxiv - Microbiology 2024Quote: ... from HIV-1 infected cells was digested and ligated with linkers using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs) and its associated protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were used to constructed libraries using NEB Next Ultra DNA Library Prep Kit for Illumina (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT) within loxP-N with the lox17:2272 site (ATAACTTCGTATAGGATACTTTATAGCAATTTAT) using a Q5 Site-Directed Mutagenesis kit (New England Biolabs) and PCR ...
-
bioRxiv - Molecular Biology 2024Quote: High molecular weight genomic DNA was extracted from homozygous hDMDTg and hDMDTgSc mice liver using the Monarch HMW DNA Extraction Kit for Tissue (NEB). Oxford Nanopore Technologies Promethion genome sequencing was performed as a service by Novogene ...
-
bioRxiv - Neuroscience 2024Quote: ... DNA fragments were generated by PCR amplification and then fused with the backbones using NEBuilder HiFi DNA assembly kit (New England Biolabs). Resulting plasmids were verified by sequencing (GeneWiz).
-
bioRxiv - Microbiology 2024Quote: Plasmid pET28bR109H for overexpression of the R109H mutant was obtained by site-directed mutagenesis of plasmid pET28bRho (kindly provided by Pr. James Berger, Johns Hopkins University) using the NEBuilder HiFi kit (New England Biolabs). The R109H mutant was overexpressed in BL21(DE3)pLysS cells carrying the pET28bR109H plasmid and purified as described for WT Rho 105.
-
bioRxiv - Microbiology 2024Quote: ... Libraries for Illumina sequencing (average insert size: 700 bp) were prepared using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs) and sequenced using Illumina MiSeq to generate 300 bp paired-end reads ...