Labshake search
Citations for New England Biolabs :
651 - 700 of 6948 citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... A set of Gibson Assembly (New England Biolabs, Inc.) primer pairs (RicT-F2 and RicT-R2 ...
-
Microhomology-Mediated Circular DNA Formation from Oligonucleosomal Fragments During SpermatogenesisbioRxiv - Genomics 2023Quote: ... NEBNext Multiplex Oligos for Illumina (Set 1, NEB #E7600) were used for PCR amplification of adaptorLJligated DNA ...
-
bioRxiv - Molecular Biology 2023Quote: Small RNA Library Prep Set for Illumina (NEB, E7300S). In preparing the library ...
-
bioRxiv - Cancer Biology 2023Quote: ... and a NEBNext Multiplex Oligos set (e.g., NEB E7335S). An initial test amplification was used to determine the optimal cycle number for each library ...
-
bioRxiv - Microbiology 2024Quote: ... alongside a set amount of 100bp DNA ladder (NEB) and run for 1hr at about 90V for quantification ...
-
bioRxiv - Microbiology 2020Quote: ... and Protoscript II RT (NEB). 10 μl of cDNA was PCR amplified for 18 cycles with Illumina TruSeq primers and Phusion DNA polymerase ...
-
bioRxiv - Microbiology 2022Quote: ... LunaScript RT SuperMix Kit (NEB) was used to generate cDNA using 1μg RNA ...
-
bioRxiv - Cell Biology 2023Quote: ... Luna WarmStart RT (NEB, M3002) was used for primer extension at 55 ⁰C ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-PCR was performed with 2 μl of the reverse transcription positive reactions and Phusion High Fidelity DNA polymerase (NEB, Ipswich, MA) following manufacturer’s protocols on an Applied Biosystems 2720 Thermal Cycler ...
-
bioRxiv - Physiology 2023Quote: ... RT-qPCR (quantitative reverse transcriptase PCR) was then performed using a Luna® Universal One-Step RT-qPCR Kit (New England Biolabs; E3005) per manufacturer’s instructions and primers for the CaSeq1 gene of interest (IDT ...
-
bioRxiv - Genomics 2019Quote: ... The microRNA-Seq library was constructed using NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) following the instructions provided by the manufacturer (NEB, E7300S/L, USA). The library construction was started with 800ng total RNA ...
-
bioRxiv - Microbiology 2021Quote: ... with Luna Universal One-Step Rt-qPCR & Probe One-Step RT-qPCR Kits (NEB, USA), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using Luna Universal One-Step RT-qPCR kit (NEB, Cat. # E3005E) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... The RT-qPCR was performed using Luna One Step RT-qPCR mix with dUDG (NEB). Amplification using Luna One Step qPCR mix with UDG (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reverse-transcription (RT) reactions were performed with 2X LunaScript® RT SuperMix Kit (NEB) with 5 μL of RNA input in 10 μL total volume ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR was performed using a Luna ® Universal One-Step RT-qPCR kit (NEB) in a CFX96 qPCR thermocycler (BioRad) ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-qPCR was performed using Luna® Universal One-Step RT-qPCR Kit (E3005S, NEB). 20μl reactions using 200nM primers and <100ng RNA were run on ABI StepOnePlus Real Time PCR system following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was done with 100ng of RNA with the Luna RT-qPCR kit (NEB) using primers targeting beta actin as a control (Table S2) ...
-
bioRxiv - Microbiology 2019Quote: ... the first PCR was performed in triplicate with tailed forward and reverse primers using NEBNext Q5® Hot Start HiFi PCR Master Mix (New England BioLabs, Hitchin, UK) and 17 and 25 cycles for the bacterial and functional marker ...
-
bioRxiv - Neuroscience 2019Quote: ... The cassette was amplified by PCR then ligated to the donor template using Gibson Assembly Master Mix (NEB, primers in Supplementary Table 3). The reaction was incubated at 50 °C for 15 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... with TdTomato was amplified by PCR with primers (5’- ggcgcgCCCCCCTCTCCCTCCCCCCC -3’ and 5’- ggcgcgccTTACTTGTACAGCTCGTCCATGCCGTACAG -3’) using Hot start Q5® polymerase (NEB, Frankfurt, Germany) from LeGO-iT (a gift from Boris Fehse ...
-
bioRxiv - Genetics 2022Quote: Primers specific for the region were designed using primer-BLAST and PCR amplification of the region was performed with Q5 DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). PCR product was then sequenced by reverse primer ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the C-terminus of clpP1 were amplified by PCR using the A–B and C–D primer pairs from Table 2 (Phusion polymerase, GC buffer, New England Biolabs, Ipswich, United States). For clpP2 ...
-
bioRxiv - Microbiology 2023Quote: ... the plasmid backbone was amplified by PCR using primers P9 and P10 and the Q5 DNA polymerase (New England Biolabs, USA, NEB #M0491). These primers were obtained from Eurofins Genomics (Germany ...
-
HTLV-1 Splice Sites in Prevalent Gene Vectors Cause Splicing Perturbations in Transgenic Human CellsbioRxiv - Genomics 2023Quote: ... Following magnetic bead purification one third of the cDNA per sample was subjected to PCR amplifications with the primers HTLV-1 and PE-2nd-GA using the NEBNext® Ultra™ II Q5® Master Mix (NEB) using the cycling program ...
-
bioRxiv - Genetics 2023Quote: ... 100 pmol of template oligos and 125 pmol IRDye 700-labeled reverse complement primer F1 were mixed in Phusion® High-Fidelity PCR Master Mix (NEB, Ipswich, MA). A 15s denaturing at 95°C following a 10-minute extension at 52°C afforded duplex DNAs ...
-
bioRxiv - Physiology 2024Quote: ... and PCR was performed with Flag F (caaggacgacgatgacaaagtc) + 3’OUTR (CAGAGCCAACAACGTGAGGT) primers using Q5® High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... The following PCR primers were used to amplify cut sites with Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA, USA): IRF4 5’ - AGGTGCCTTCTTCCGGGG – 3’ & 5’ - TTGCGTGGAAACGAGAACGC – 3’ ...
-
bioRxiv - Genomics 2020Quote: ... oligo d(T)23VN primer (NEB) was annealed to template RNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... using NEBNext Indexing primers (E7335, NEB), and the libraries pooled and sequenced on the MiSeq system (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... 5uL random primer mix (NEB, S1330), and 39.5uL RNase free H2O ...
-
bioRxiv - Immunology 2020Quote: ... and random hexamer primers (NEB, UK). The cDNA reaction was incubated for 60 min at 40°C ...
-
bioRxiv - Immunology 2023Quote: ... Primers (IDT) were phosphorylated (PNK, NEB) followed by 25 cycles of PCR using KAPA HiFi master mix (KAPA Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Dual Index Primers (NEB #E7600) were used for library preparation with ChIP-seq.
-
bioRxiv - Cell Biology 2023Quote: ... and Random Primer Mix (NEB, S1330S).
-
bioRxiv - Genomics 2024Quote: ... 2.5μL NEBNext Index primer (NEB, E7335S), 2.5μL NEB Universal Primer ...
-
bioRxiv - Physiology 2021Quote: ... The full length ayRhp1 sequence was obtained following two rounds of RT-PCR using Phusion High Fidelity taq polymerase (New England Biolabs, Ipswitch, MA, USA) and NucleoSpin gel purification (Macherey-Nagel ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reverse transcription and quantitative PCR were performed in one step using the Luna Universal One-Step RT-qPCR Kit (New England BioLabs, Ipswich, MA, USA). The primers used are listed in supplemental table (Table ...
-
bioRxiv - Immunology 2022Quote: ... The Multiplex Small RNA Library Prep Set (New England Biolabs) was used to produce small RNA libraries ...
-
bioRxiv - Genetics 2023Quote: ... seven independent reactions were set up where the EcoRI (NEB), PsiI (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Equimolar amounts of universal scaffold primer and target region primers were used with Q5 DNA polymerase (NEB). Cycling parameters included a touchdown PCR protocol ...
-
bioRxiv - Systems Biology 2019Quote: ... RT-qPCR was performed with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs). 1 μl of 10-fold diluted RNA was added to 4 μl of rtPCR mix and subjected to a reverse transcription step at 55°C and 45 cycles of PCR (10 seconds at 95°C and 30 seconds at 60°C) ...
-
bioRxiv - Microbiology 2021Quote: ... SYBR green based RT-qPCRs were performed using Luna Universal One-Step RT-qPCR Kit (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR was performed by using Luna Universal One-Step RT-qPCR reagents (New England Biolabs). Primers targeting the MS2 stem-loop regions were used for quantifying repeat RNA expression levels ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR was performed using Luna® Universal One-Step RT-qPCR Kit (New England Biolabs), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-qPCR was performed with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) according to manufacturer’s instruction on an iQ5 Real-Time PCR System (Bio-Rad) ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-qPCR was performed by using Luna Universal One-Step RT-qPCR reagents (New England Biolabs), following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was then performed using Luna Universal One-step RT-qPCR kit (New England Biolabs) following the provided protocol on a BioRad CFX Opus 96 quantitative Real-Time PCR machine ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5 µl of the dissolved cells were added to a 50 µl PCR reaction (Q5 DNA polymerase, NEB; see Table S2 for primer sequences) and amplified with 36 rounds of thermal cycling ...
-
bioRxiv - Microbiology 2019Quote: ... or LunascriptTM RT (New England Biolabs) (sven5105-5107 variants) ...