Labshake search
Citations for New England Biolabs :
551 - 600 of 6948 citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... and then used as the template for an additional 6 cycles of PCR amplification with NEBNext i5 and i7 primers (NEB #E7600S).
-
bioRxiv - Genomics 2020Quote: ... Reverse transcription product was purified using a DNA Clean and Concentrator-5 and used as the template for PCR amplification using i5 and i7 dual indexing primers (NEB #E7600S).
-
bioRxiv - Genetics 2022Quote: ... A 569-bp region of dng102 was amplified by PCR with JIG-339 and JIG-340 primers and digested with Hpy188I (NEB # R0617S). This amplicon has two Hpy188I sites in wild-type ...
-
bioRxiv - Genomics 2022Quote: ... The Hi-TrAC libraries were then amplified with multiplexing indexed primers in the following reaction mixture: 20 μL Phusion HF PCR Master Mix (NEB, M0531S), 1 μL Illumina Multiplexing PCR primer 1.0 (10 μM) ...
-
bioRxiv - Microbiology 2022Quote: ... containing ampicillin resistance marker were amplified by PCR with corresponding primers (Supplementary Data 4) in Q5® High-Fidelity 2X Master Mix (New England BioLabs). Both the insert (MCR-MOR ...
-
bioRxiv - Genetics 2022Quote: An 867-bp region of mdr1 was amplified by PCR with primers W22-Ros1-F1 and W22-Ros1-R1 and digested with TaqI-v2 (NEB #R0149S). The different mdr1 alleles could be distinguished by the pattern of restriction fragments due to the presence of SNPs that created or removed TaqI restriction sites in different genetic backgrounds (Kermicle’s mdr1 allele or its progenitor in W22 ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR amplifications of rbcL sequences were performed with the RbcL-M-F and RbcL-M-R primers using PCR Ready Mix (BioLabs, Israel), and 50ng DNA-template ...
-
bioRxiv - Genomics 2021Quote: NGS libraries were generated by amplifying the CUT&Tag DNA fragments with i5 and i7 barcoded HPLC-grade primers (Buenrostro et al., 2015) (Supplementary Table 6) with NEBNext® HiFi 2x PCR Master Mix (New England BioLabs) on a thermocycler with the following program ...
-
bioRxiv - Microbiology 2019Quote: ... plus 280 nM each primer and the standard reagents in the Phusion High-Fidelity PCR Kit (New England BioLabs, Ipswich, MA). Samples were then cycled under the following qPCR conditions ...
-
bioRxiv - Genetics 2020Quote: ... PMO-induced alternative splicing of ush2a transcripts was analysed by PCR amplification using primers in zebrafish ush2a exon 11 using Q5 HF DNA polymerase (New England Biolabs, #M0491L). Primer sequences are provided in table S2 ...
-
bioRxiv - Microbiology 2021Quote: Cloning of the plf gene clusters and plfG and papG genes encoding the different classes of adhesins were obtained by PCR amplification using specific primers (Table 2) and Q5 High Fidelity-DNA polymerase (New England Biolabs [NEB]). The A-Tailing Kit (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... The gRNA templates were amplified by PCR with scaffold reverse primer then were transcribed with HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) [22] ...
-
bioRxiv - Microbiology 2021Quote: ... were done with PCR probes produced with a forward primer previously radiolabelled with [γ-32P]-dATP by the T4 polynucleotide kinase (New England Biolabs). Protein-DNA interaction was performed with variable concentrations of rCovR ...
-
bioRxiv - Genomics 2021Quote: ... PCR amplification of the samples was performed using Nextera primers 1 and 2 and NEBNext High fidelity master mix (NEB, M0541S) for 12 cycles as determined by KAPA Real-Time Library Amplification Kit (Peqlab ...
-
bioRxiv - Genomics 2022Quote: ... ERCC-00048 DNA with an upstream T7 promoter was cloned into pUC19 and PCR amplified (primers in Table S9) with Phusion polymerase (New England Biolabs M0530S) using the following cycling conditions ...
-
bioRxiv - Microbiology 2022Quote: ... The sequencing ladders were obtained from hlgCB or hlgB PCR products (amplified with primers listed in Supplementary Table S2) and the Vent (exo-) DNA polymerase (NEB Biolabs). All samples were fractionated on a 10% polyacrylamide −8 M urea gel in 1x TBE ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL was used as input in a second round PCR amplification to attach Illumina adaptors and dual index primers (NEB, E7600S) for five PCR cycles using Q5 HotStart-High-Fidelity 2X Master Mix with an annealing temperature of 65°C for 20 seconds and an extension time of 1 minute ...
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR reactions were performed with a final primer concentration of 1 mM using Q5® High-Fidelity 2X Master Mix (NEB). Equal volumes of X and Y PCR reactions were then combined ...
-
bioRxiv - Neuroscience 2023Quote: ... PCRs to confirm targeted and untargeted SMN2 loci were performed for each of the cell lines with primer pairs shown in table 1 using High-Fidelity 2X PCR Master Mix (NEB, M0541L) and Thermal Cycler C1000 Touch (Bio-RAD) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL was used as input in a second round of PCR to attach on Illumina adaptors and dual index primers (NEB, E7600S) for five PCR cycles using Q5 HotStart-High-Fidelity 2X Master Mix with an annealing temperature of 65°C for 20 seconds and an extension time of 60 seconds ...
-
bioRxiv - Plant Biology 2022Quote: ... the full region including the HrpL box promoter was PCR-amplified using primers (Supplementary Table S2) and Q5 High-Fidelity DNA Polymerase (NEB, USA). The resulting PCR fragment was gel-purified and was blunt-end-ligated into the Eco53kI (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... the plasmid backbone was amplified by PCR using primers P9 and P10 and the Q5 DNA polymerase (New England Biolabs, USA, NEB #M0491). These primers were obtained from Eurofins Genomics (Germany ...
-
bioRxiv - Molecular Biology 2022Quote: ... pCS2+ backbones containing ACVR1 or an FOP-ACVR1 mutant were PCR amplified with the mutant primer using Phusion high fidelity polymerase (NEB, M0530). Mutated plasmids were transformed into Top10 chemically competent cells and DNA from individual colonies was submitted for Sanger sequencing ...
-
bioRxiv - Genomics 2023Quote: ... DNA fragments were further size-selected by agarose gel elution and PCR amplified for 6 to 8 cycles using Illumina P1 and Index primer pair and Phusion® High-Fidelity PCR Master Mix (New England Biolabs). The final library was purified using Agencourt AMPure XP beads and quality assessed by Agilent Bioanalyzer 2100 (DNA 7500 kit ...
-
bioRxiv - Cell Biology 2023Quote: ... The odf3l2a template was amplified from total RNA with T3 and T7 sites on the forward and reverse primers respectively and the DIG-labeled antisense probe was synthesized directly from purified PCR product using T7 RNA polymerase (NEB M0251S). The ankef1a and saxo2 probe templates were amplified from total RNA with gene specific primers and cloned into the pCR4-TOPO vector (Thermo Fisher 450071) ...
-
bioRxiv - Immunology 2023Quote: ... The mRuby-OAS3 CDS and mRuby2 were amplified via PCR and primers (Supplemental table 1) and inserted into pLenti-PGK-PuromycinR via Gibson assembly (New England Biolabs: E2611S). The pLenti-mRuby2-PABPC1 is described in Burke et al. ...
-
bioRxiv - Genomics 2023Quote: ... was cloned between residues 34 and 35 with primers ag424 and ag425 using inverse PCR with Q5 polymerase (New England Biolabs, NEB).23 The sequences of all primers used in this study are presented in Table S2 ...
-
bioRxiv - Genomics 2023Quote: ... 21 µl of DNA was mixed with 2 µl of universal i5 and i7 primers (Buenrostro et al. 2015) and 25 µl of NEBNext HiFi 2X PCR master mix (NEB #M0544). Samples were amplified in a thermocycler as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting products were pre-amplified in a 100 μL reaction using 10 cycles with 4 μL pre-amp primers (10x Genomics PN 20002714) and 50 μL of NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S). Reactions were cleaned with 1.6X SPRI and eluted in 40 μL EB ...
-
bioRxiv - Genomics 2023Quote: ... and the adaptor ligated cDNA was amplified with 12 cycles of PCR with NEBNext Primer Mix (96 Unique Dual Index UMI Adaptors RNA set1, (NEB #E7416). Equimolar amounts of the samples were then pooled and sequenced using NextSeq 500/550 70 base read lengths in paired-end mode.
-
ADEVO: Proof-of-concept of Adenovirus Directed EVOlution by random peptide display on the fiber knobbioRxiv - Bioengineering 2023Quote: ... the whole shuttle plasmid was PCR-amplified with overlapping primers containing the desired insert and recircularised by NEBuilder (New England Biolabs, #E2621L) recombination.
-
bioRxiv - Molecular Biology 2024Quote: ... Amplification of 4 µl circularized cDNA was performed in a reaction volume of 48 μl in the presence of 500 nM PCR forward primer (AATGATACGGCGACCACCGAGATCTACA*C, where * is a phosphorothioate bond) and indexed NEBNext® Multiplex Oligoes for Illumina (NEB), 0.48 U KAPA HiFi Polymerase (KAPA Biosystems) ...
-
bioRxiv - Genetics 2024Quote: ... Each of the four cDNA products was then used as a template in a PCR with the same primers and Phusion® High Fidelity DNA Polymerase (New England Biolabs). All primer pairs were located within the 5’- and 3’-UTRs of the transcripts so that they amplified the entire protein coding sequence of the respective genes (Figure 1 ...
-
bioRxiv - Genetics 2024Quote: ... DNA was isolated from HepG2 cells and the regions were amplified with PCR primers containing restriction enzyme (RE) cutting sites for NsiI (New England Biolabs, NEB) and BamHI/HindIII (NEB ...
-
bioRxiv - Genomics 2024Quote: ... The cDNA was then used as input for the first-round PCR with oJL105 and oJL106 to add the i5/i7 primer sites using Q5 DNA polymerase (NEB M0491L). Libraries were amplified with an initial 98 °C denaturation step for 30 s ...
-
bioRxiv - Microbiology 2021Quote: ... The RT-qPCRs with Luna Universal One-Step RT-qPCR kit (NEB, USA) were performed according to the protocol of the manufacturer ...
-
bioRxiv - Genomics 2022Quote: ... RT-qPCR was performed using Luna Universal One-Step RT-qPCR kit (NEB) using the following primers ...
-
bioRxiv - Microbiology 2021Quote: ... and random primer mix (NEB) before amplification by the ARTIC Network protocol using the multiplexed primer scheme version 3 ...
-
bioRxiv - Plant Biology 2020Quote: ... random primer mix (NEB #S1330S) and M-MLV Reverse transcriptase (Invitrogen #28025-013 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and random primers (NEB, S1330S) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... and random primer mix (NEB). Aliquots were then made of the experimental working concentration dilutions of cDNA to reduce freeze-thaw cycles ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and Random Primer Mix (NEB) for quantification by RT-qPCR with SYBR Green Master Mix ...
-
bioRxiv - Molecular Biology 2020Quote: ... Random Primer 6 (NEB, #S1230S), RNasin Ribonuclease inhibitor (Promega ...
-
bioRxiv - Genomics 2021Quote: ... standard Illumina primers (NEB #E7335S) and sequencing chemistry were used ...
-
bioRxiv - Physiology 2021Quote: ... random primers (BioLabs New England), dNTP mix 10mM (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... random primer mix (NEB #S1330S) and M-MLV Reverse transcriptase (Invitrogen #28025-013 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Dual index primers (NEB #E7780S) for sequencing on Illumina MiSeq and NovaSeq platforms were added by amplifying the tagmented samples using Q5 polymerase (NEB #M0544S ...
-
Vps18 contributes to phagosome membrane integrity in Mycobacterium tuberculosis-infected macrophagesbioRxiv - Microbiology 2023Quote: ... Index Primers (New England Biolabs). Libraries were sequenced on an Illumina NextSeq500 ...
-
bioRxiv - Genomics 2024Quote: ... and random primer 6 (NEB). The NEBNext Ultra II Non Directional RNA Second Strand Synthesis Module was subsequently used to convert single-stranded cDNA to double-stranded cDNA ...
-
bioRxiv - Microbiology 2020Quote: The real-time PCR technique was performed for NDV detection using Luna Universal One-Step RT-qPCR Kit E3005E (New England BioLabs, USA) following the manufacture procedures ...