Labshake search
Citations for New England Biolabs :
801 - 850 of 6948 citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: NEBNext ChIP-seq Library Prep Master Mix Set for Illumina (E6240L, NEB)
-
bioRxiv - Genomics 2022Quote: ... using NEBNext ChIP-seq Library Prep Master Mix Set for Illumina (NEB) and NEBNext Ultra DNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... NEBNext Multiplex Small RNA Library Prep Set for Illumina (New England Biolabs) was used to prepare libraries for further sequencing according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... NEBNext Multiplex Small RNA Library Prep Set for Illumina (New England Biolabs) was used ...
-
bioRxiv - Cell Biology 2019Quote: A PCR amplified genomic DNA fragment using forward primer 5’-CGATCCTCTTGCCTCCATGT-3’ and reverse primer 5’-CCAGCTGTTCGCGTTCATA-3’ was digested with XmnI (NEB; R0194L). Undigested and digested samples were proceeded for electrophoresis using 2% agarose gels.
-
bioRxiv - Molecular Biology 2022Quote: ... The cDNA was diluted 1/8 in nuclease-free water and used as template for a first touch-down RT-PCR reaction primed with a high-specificity primer (71°C annealing Tm) and a universal reverse primer using Q5 High-Fidelity polymerase (New England Biolabs, USA). The PCR product of this first RT-PCR was then diluted 1/100 in nuclease-free water and used as a template for a semi-nested RT-PCR using a gene-specific primer and the universal reverse primer ...
-
bioRxiv - Microbiology 2020Quote: ... was PCR amplified with forward primer (5’CGCGGATCCATGGATTTGTTTATGAGAATCTT3’) and reverse primer (5’ AAGGAAAAAAGCGGCCGCCAAAGGCACGCTAGTAGTC3’) by using Phusion High-Fidelity DNA Polymerase (New England Biolabs, M0530L) according to the manufacturer’s protocol and inserted into pcDNA5.1/FRT/TO vector (a kind gift from professor Torben Heick Jensen ...
-
bioRxiv - Microbiology 2022Quote: ... A second amplification round was performed with a primer bearing a P5 Illumina sequence and P7 indexed Illumina primers (NEB#E7335S). Primer sequences are available on request ...
-
bioRxiv - Biophysics 2023Quote: ... we amplified 10 fmol of the original oligo library with unmodified 500 nM primer Z6 and 500 nM primer Z13 with Phusion polymerase (NEB, M0530L). The product was purified following manufacturer’s specifications ...
-
bioRxiv - Bioengineering 2024Quote: ... Target cDNA were then amplified using one primer that annealed specifically to the target RNA and a second primer that annealed specifically to the rcRNA (primers 45/46 for dmd and primers 47/48 for lmna) with Q5® High-Fidelity DNA Polymerase (New England Biolabs) for 35-cycles.
-
bioRxiv - Bioengineering 2020Quote: ... We added 1 μL of the resulting DNase digestions to 10 μL RT-qPCR reactions (Luna One-Step Universal RT-qPCR Kit, New England Biolabs) containing 0.8 U/μL RNasin Plus (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... 4μL purified RNA were subsequently used for RT-qPCR reaction using the Luna Universal One-Step RT-qPCR kit (New England Biolabs) and 0.4μM of each primer ...
-
bioRxiv - Cell Biology 2021Quote: Intracellular levels of mRNA for TRAP complex subunits were estimated by RT-qPCR using Luna Universal One-Step RT-qPCR Kit (NEB) following total RNA isolation with RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA copies were quantified in 10% of the obtained eluate volume with a one-step RT-qPCR reaction using a standard curve and the Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs) and previously published TaqMan primers and probe (Corman et al. ...
-
bioRxiv - Microbiology 2021Quote: ... RNA levels of target proteins were subsequently quantified by using RT-with the Luna Universal One-Step RT-qPCR Kit (NEB) in an Applied Biosystems QuantStudio 7 thermocycler using gene-specific primers ...
-
bioRxiv - Immunology 2020Quote: ... We quantified RNA using a one-step RT qPCR reaction with the NEB Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs) and previously published TaqMan primers and probes (SARS-CoV-2 E_Sarbeco and hamster RPL18 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Other G2L4 and GII RT mutant plasmids were derived from pMal-G2L4 RT or pMal-GII RT by using a Q5 mutagenesis kit (New England Biolabs).
-
bioRxiv - Microbiology 2022Quote: Detection of viral genomes from heat-inactivated samples was performed by RT-qPCR using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 specific primers targeting the N gene region (5′-TAATCAGACAAGGAACTGATTA-3′ and 5′-CGAAGGTGTGACTTCCATG-3′ ...
-
bioRxiv - Genetics 2023Quote: ... RT-qPCR was performed on 10 ng total RNA using the Luna Universal One-Step RT-qPCR Kit (NEB, E3005L). bin3 ...
-
bioRxiv - Systems Biology 2023Quote: ... RT-qPCR quantification was carried out on 20 ng of RNA with the Luna One-Step RT-qPCR Kit (NEB). All qPCRs were performed in technical triplicates ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.5 μl ProtoScript II RT (NEB-kit) was added to each sample ...
-
bioRxiv - Genomics 2019Quote: ... fragmented and reverse transcribed using protoscript RT (NEB), second strand synthesized (NEB) ...
-
bioRxiv - Immunology 2021Quote: ... LunaScript™ RT SuperMix Kit (New England Biolabs) was used to generate cDNA from 850 ng of total RNA following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and reverse transcribed with LunaScript RT SuperMix (NEB). Real time PCR amplification was performed on a BioRad CFX96 Real-Time PCR detection system using the following primer sets ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μl 4× Template Switching RT buffer (NEB), 1 µl of 75 μM T7-TSO (5’-/5Biosg/ACTCTAATACGACTCACTATAGGGAGAGGGCrGrGrG-3’) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-4-points were induced in the miR-29a seed binding site using the Q5 Site Directed Mutagenesis Kit (NEB, Cat#E0554S). 20 ng of recombinant dual-luciferase plasmid and 6 pmol of either miR-29a mimic or scrambled control were mixed with 100 μL Opti-MEM containing 1 μL lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Add 30 μl PCR master mix (2.5 μl Illumina dual indexes primer 1, 2.5 μl Illumina dual index primer 2, 25 μl NEB Q5 HotStart Master Mix) to the 20 μl beads bound with samples ...
-
bioRxiv - Microbiology 2023Quote: ... 10 ng of library DNA was amplified with the p7 primer and the IS-Seq Step1 primer (Table S5) for 13 cycles using Q5 2X Master Mix (New England Biolabs, Ipswich, MA). These reaction products were diluted 1:100 and 10 µL was added to a PCR reaction with the p7 primer and the IS-Seq Step2 primer for 9 cycles using Q5 2X Master Mix ...
-
bioRxiv - Microbiology 2021Quote: ... Otogenetics employed the NEBNext Multiplex Small RNA Library Prep Set for Illumina (NEB) coupled with automated agarose gel size selection (30 to 200 nt ...
-
bioRxiv - Neuroscience 2022Quote: ... and the NEBNext Small RNA library prep set for Illumina (New England Biolabs). Libraries were sequenced on a NextSeq550 on a 75 cycles flow cell.
-
bioRxiv - Molecular Biology 2022Quote: ... ChIP-Seq libraries were prepared using NEBNext Library Prep Master Mix Set (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... A 100 µL IVT reaction is set using HiScribe T7 polymerase (NEB #E2040S). The reaction contained ...
-
bioRxiv - Microbiology 2020Quote: ... lot 0091412 and the NEBNext multiplex Oligos for Illumina (Set 2, NEB #E7500) lot 0071412 ...
-
bioRxiv - Molecular Biology 2019Quote: A 100 μL IVT reaction is set using HiScribe T7 polymerase (NEB #E2040S). The reaction contained ...
-
bioRxiv - Microbiology 2020Quote: ... 10 pmoles of each oligonucleotide set were annealed in 1X CutSmart buffer (NEB) and 0.1 pmole of the annealed products were ligated with 50 ng of the linearized pCsm vector with T4 DNA ligase (NEB) ...
-
bioRxiv - Immunology 2021Quote: ... NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (NEB cat# E6240L) was used for ChIP-seq library preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reaction was set up using ARCA (NEB, S1411L or Trilink, N-7003-5) and N1-Methylpseudouridine-5’-Triphosphate (Trilink ...
-
bioRxiv - Developmental Biology 2023Quote: ... were ligated using NEBNext DNA Sample Prep Reagent Set 1 (New England Biolabs). Immunoprecipitations were carried out using 500ng DNA per sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... from COLO205 cells was subjected to one-step RT-qPCR analysis using the Luna Universal One-Step RT-qPCR Kit (NEB, E3005S) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 1-step RT-qPCR was performed on 2μL of RNA using the Luna® Universal One-Step RT-qPCR Kit (NEB Biosciences) and primers for β-tubulin (F ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was diluted 1:50 for RT-qPCR which was conducted using the Luna Universal One-Step RT-qPCR kit (New England Biolabs E3005E) on a C1000 touch thermal Cycler / CFX384 Real-Time System (Biorad) ...
-
bioRxiv - Microbiology 2024Quote: ... RT-qPCR reactions were carried out in 10 μL reactions using the Luna® One-Step Universal RT-qPCR kit (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... First strand cDNA was synthesised using random primers (NEB). Following second strand cDNA synthesis ...
-
bioRxiv - Microbiology 2019Quote: ... NEBNext® Multiplex Oligos for Illumina® primers (NEB) were used ...
-
bioRxiv - Microbiology 2019Quote: ... Primers were designed using NEBase Changer (New England Biolabs) software (Table S1) ...
-
bioRxiv - Microbiology 2019Quote: ... Primers were tailed to allow subsequent Gibson Assembly (NEB) cloning of amplicons at the EcoRI and XhoI sites of the shuttle vector pGREG533 (Euroscarf) ...
-
bioRxiv - Genomics 2019Quote: ... The reverse primers are phosphorylated using Polynucleotide kinase (NEB).
-
bioRxiv - Evolutionary Biology 2020Quote: ... with primers AAVS1_CAG_fl_STOP_fl_F & R to introduce MluI (NEB, R3198S) and KpnI (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... and 1 μl Random Primer Mix (60 μM, NEB) at 65°C for 5 minutes and then chilled on ice ...
-
bioRxiv - Molecular Biology 2021Quote: ... using primers compatible with Gibson assembly cloning (NEB, E2611). The targeting vector was generated starting from the 3-SB-EF1-PBBAR-SB plasmid48 ...