Labshake search
Citations for New England Biolabs :
651 - 700 of 917 citations for Coiled Coil Domain Containing 28B CCDC28B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: A-pixels were degraded by incubating the cells in a 50 μl reaction containing 1 U USER enzyme (New England Biolabs) in Wash Buffer ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve transcripts and viral RNA in the samples were reverse transcribed with a reverse E1 primer containing a nongenomic tag sequence74 5’-CAGACAGCACTCGTTCGTACAC-3’ through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). The (+ ...
-
bioRxiv - Microbiology 2023Quote: ... PCR amplified target genes and pQE60 plasmid (containing an IPTG inducible T5 promoter) were digested with BamHI and HinDIII (New England Biolabs) and purified by gel extraction (MinElute gel extraction kit ...
-
bioRxiv - Immunology 2023Quote: Circularized DNA templates were prepared by incubating 300 nM of template oligo with 200 nM padlock probe in a 50 μl ligation reaction containing 1mM ATP and 400U of T4 DNA ligase (New England Biolabs) in a buffer comprising 33 mM Tris.acetate (pH 7.9) ...
-
bioRxiv - Genomics 2023Quote: ... and washed twice with 2 mL of CLB containing Superase-In and 1% v/v of 20 mg/mL molecular grade BSA (NEB). After the final wash ...
-
bioRxiv - Genetics 2023Quote: ... The PCR products containing the RB border and the PgpdA-geneticin1-664 were digested with XhoI (New England Biolabs, UK) and ligated using T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Biochemistry 2022Quote: ... from which a 500 bp dsDNA containing the λC31 attB at its center was generated by PCR using Phusion High Fidelity PCR Master Mix from NEB. After heat denaturation ...
-
bioRxiv - Biochemistry 2022Quote: ... The abasic site interstrand cross-link (ICLAP)-containing duplexes were ligated into the linearized plasmid backbone using T4 DNA ligase (NEB). The ligated plasmid was dialyzed into TE pH 8.0 buffer and concentrated using an Amicon Ultra-15 10 kDa molecular weight cut-off filter unit ...
-
bioRxiv - Cancer Biology 2023Quote: ... The plasmid already containing MLANA and λN-ADAR2DD(-NLS) was opened by restriction digestion with the enzyme ClaI (NEB, #R0197). The six PCR products were then inserted into the ClaI-digested plasmid in a single reaction with NEBuilder (NEB ...
-
bioRxiv - Biophysics 2022Quote: ... The HiBit-Hsp70 insert was PCR-amplified directly from pEGFP-Hsp70 plasmid using primers containing the HiBit sequence and then inserted using AgeI and XbaI (NEB), which is SpeI compatible ...
-
bioRxiv - Cell Biology 2023Quote: ... then the reactions were made to a total volume of 80 µL containing 1 equivalent of GlycoBuffer2 and 3–5 µL of Remove-iT PNGase F (P0706, NEB), incubated at 37°C for 2 hours ...
-
bioRxiv - Developmental Biology 2023Quote: ... MNase digestion was performed in 100 µl of digestion buffer containing 1 mM CaCl and 40 U of Mnase (New England Biolabs) at 24°C for 15min while shaking ...
-
bioRxiv - Neuroscience 2023Quote: Control and DRP1 gRNA were cloned into a plasmid containing a U6 promoter using BstXI and BlpI restriction enzymes (NEB) (gifted by Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... vector containing aa1-255 of Cnn was digested with KpnI and SspI and a complementary fragment containing the point mutations was cloned into the cut vector using HiFi technology (NEB). The complementary fragment was generated by GENEWIZ ...
-
bioRxiv - Biochemistry 2023Quote: ... The same construct containing a blasticidin-S deaminase (BSD) gene in place of PAC was generated by Gibson assembly (NEB) using primers ZJ1-ZJ4 (Table S2) ...
-
bioRxiv - Genomics 2023Quote: ... we amplified the library using PCR with a 10 µl reaction mixture containing 5 µl of Phusion High Fidelity MASTER Mix (New England Biolabs), 2 µl of P1 primer (AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC G) ...
-
bioRxiv - Neuroscience 2023Quote: ... a DNA fragment containing hU6 and shRNA was amplified from pLKO.1-shRNA using Phusion High-Fidelity DNA Polymerase (NEB) with primers that introduced SpeI restriction sites (Forward Primer ...
-
bioRxiv - Cell Biology 2023Quote: ... Double-stranded cDNA was generated by second-strand synthesis via the nick translation method using a mix containing 2Lμl of RNAse H (NEB, #M0297S), 1Lμl of E ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated for 30 min at 37°C in appropriate media containing 3µM of cell-permeable SNAP-Cell® 647-SiR (New England BioLabs). Cells were then rinsed twice with fresh media and incubated for 30min at 37°C ...
-
bioRxiv - Systems Biology 2023Quote: ... and used as the template for PCR with primers containing gene-specific targeting homology arms (1x Q5 Master Mix, New England Biolabs #M0494S ...
-
bioRxiv - Microbiology 2023Quote: ... RHCas9 Δgra72 parasites were co-transfected with plasmids containing sgRNAs specifically targeting the UPRT locus and SacI (New England Biolabs)-linearized pTwist-CMV: ...
-
bioRxiv - Microbiology 2023Quote: ... RH-Luc+ Δgra47 or ME49-cLuc+ Δgra47 were co-transfected with plasmids containing sgRNAs specifically targeting the UPRT locus (Table S1) and EcoRV (New England Biolabs)-linearized pUPRT::GRA47HA plasmid at a ratio 1:5 of sgRNAs to linearized plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The double stranded DNA templates were then synthesized through a 200 µL PCR reaction containing 10x Taq Buffer (NEB, #B9014S), 250 µM dNTP Mix (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 bp Cy3‐UTP labeled RNA was generated using a PCR‐product containing a T7‐promoter site and the HighScribe T7 high yield RNA synthesis kit (NEB) as well as Cy3‐UTP (Jena Bioscience) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The genomic DNA region containing the integrated sgRNA was amplified by PCR using Q5 Mastermix Next Ultra II (New England Biolabs) with the LCV2_forward and LCV2_reverse primers (Table S3) ...
-
bioRxiv - Cancer Biology 2023Quote: 20 μL of the lysate DNA containing the peptide library was PCR amplified with Q5 high-fidelity DNA polymerase (New England Biolabs), for 15 cycles in a 50 μL reaction ...
-
bioRxiv - Bioengineering 2023Quote: ... For each round of selection vector DNA corresponding to the insert-containing region was amplified by PCR using either Phusion High-Fidelity enzyme or Q5 polymerase (both from New England Biolabs using Forward primer ...
-
bioRxiv - Molecular Biology 2023Quote: ... The ends of DNA were repaired by incubating in 70 μL of 1X NEBuffer 2 containing 0.6 units of T4 DNA polymerase (NEB, M0203S), 2 units of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... MARCH2 mutant constructs containing point mutations and deletions used in this study were generated by SDM using Q5 polymerase (New England Biolabs) and primers listed in Supplemental Table S2 ...
-
bioRxiv - Cell Biology 2023Quote: ... His-MBP-Mis18BP120-130 was purified using the same lysis buffer containing 500 mM NaCl and purified using amylose resin (NEB). Proteins were then eluted by an elution buffer containing 10 mM Maltose.
-
bioRxiv - Synthetic Biology 2023Quote: ... coli cells and streaked onto Luria-Burtani (LB) plates containing carbenicillin. All-by-all repressor constructs (Fig. 5c) were cloned by digestion with BsiWI-HF (NEB) and BbsI (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... was generated using primers 2238–2027 The RNAs were synthesized in 50 μl reactions containing T7 RNA polymerase (25 units; New England Biolabs), 40 mM Tris–HCl (pH 7.9) ...
-
bioRxiv - Cell Biology 2023Quote: ... zact sequence was amplified with primers containing attB sites (F: GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGGATGAGGAAATCGCTG; R: GGGGACCACTTTGTACAA-GAAAGCTGGGTAGAAGCACTTCCTGTGGACGATG) using a high-fidelity polymerase (Phusion, NEB). To create a middle entry clone pME-zact ...
-
bioRxiv - Genetics 2023Quote: ... Golden Gate Assembly reaction was carried out in a 100ul reaction containing 2.5U Esp3I (Thermo ER0452) and 1000U T4 DNA Ligase in T4 DNA Ligase reaction buffer (NEB M0202L). The reaction mix was incubated for 31 cycles alternating between 37deg ...
-
bioRxiv - Microbiology 2024Quote: ... The coverslips are then incubated for 30 min at 37°C with DMEM supplemented with 10% SVF containing 0.12 μM SNAP-Cell TMR-Star (New England Biolabs #S9105S), rinsed twice with PBS and incubated for 45 min with Dapi (1μg/ml) ...
-
bioRxiv - Biochemistry 2024Quote: ... and tRNAGln with 5 nt-long 5’ leader and same 24 nt-long 3’ trailer as tRNATyr (5–tRNAGln–24) – were transcribed in reactions containing 1x T7 RNA polymerase reaction buffer (NEB), 0.001% (w/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... before ligation to microsatellite expansion adapters containing an EcoRV restriction site (listed in Supplemental Table 1) using the T4 DNA Ligase Kit (NEB) at a 5:1 ratio overnight at 16°C ...
-
bioRxiv - Cell Biology 2024Quote: ... The amplicons were digested with SacI and EagI ligated into the plasmid containing the ATG8 promoter linearized with HindIII (New England Biolabs) and SalI (New England Biolabs) ...
-
bioRxiv - Genetics 2024Quote: ... DNA was isolated from HepG2 cells and the regions were amplified with PCR primers containing restriction enzyme (RE) cutting sites for NsiI (New England Biolabs, NEB) and BamHI/HindIII (NEB ...
-
bioRxiv - Immunology 2024Quote: Reverse-transcription on total RNA (100 to 500 ng) was performed with random hexamer/oligo-dT-Primer containing LunaScript RT Supermix (New England Biolabs) following the manufactureŕs instructions ...
-
bioRxiv - Immunology 2024Quote: ... Two microliters were subsequently used in real-time quantitative PCR reactions containing SYBR-green based Luna universal dye qPCR mix (New England Biolabs) and gene specific PCR primers ...
-
bioRxiv - Biochemistry 2023Quote: ... The pCR8[mZC3H18] plasmid was used as a template to generate subsequent ZC3H18 cDNA constructs that were cloned into a piggyBAC (pB) vector containing an N-terminal MYC tag and BSD selection marker using NEBbuilder HiFI DNA assembly (NEB). OsTIR1-HA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Sequencing libraries were generated by amplifying sgRNA sequences from genomic DNA using bar-coded Illumina-compatible adapter-containing primers and NEBNext High-Fidelity 2x PCR Master Mix (New England BioLabs). PCR products were pooled and purified with a ZymoSpin V column with Reservoir (Zymo Research) ...
-
bioRxiv - Bioengineering 2020Quote: Antibodies were first digested with PNGase F (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... or 5 µl anti-H3K18cr antibody (PTM-517, PTM Biolabs) together with protein A agarose (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... and MBP was detected with MBP antibodies (New England Biolabs).
-
bioRxiv - Biochemistry 2023Quote: ... mouse monoclonal antibodies against PAR (clone 10H, Tulip BioLabs, USA), anti-mouse antibodies conjugated with horseradish peroxidase (Bio-Rad ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl anti-MBP Monoclonal Antibody (New England Biolabs, #E8032L) and 6 μl anti-E ...
-
bioRxiv - Microbiology 2020Quote: ... the genes were PCR-amplified using primers containing cut sites for the restriction enzymes EcoRI (forward) and SalI (reverse) (New England Biolabs, NEB, Australia) for gtr29 ...