Labshake search
Citations for New England Biolabs :
6901 - 6950 of 9358 citations for Rat Leptin RIA kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... from HIV-1 infected cells was digested and ligated with linkers using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs) and its associated protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were used to constructed libraries using NEB Next Ultra DNA Library Prep Kit for Illumina (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT) within loxP-N with the lox17:2272 site (ATAACTTCGTATAGGATACTTTATAGCAATTTAT) using a Q5 Site-Directed Mutagenesis kit (New England Biolabs) and PCR ...
-
bioRxiv - Molecular Biology 2024Quote: High molecular weight genomic DNA was extracted from homozygous hDMDTg and hDMDTgSc mice liver using the Monarch HMW DNA Extraction Kit for Tissue (NEB). Oxford Nanopore Technologies Promethion genome sequencing was performed as a service by Novogene ...
-
bioRxiv - Neuroscience 2024Quote: ... DNA fragments were generated by PCR amplification and then fused with the backbones using NEBuilder HiFi DNA assembly kit (New England Biolabs). Resulting plasmids were verified by sequencing (GeneWiz).
-
bioRxiv - Microbiology 2024Quote: Plasmid pET28bR109H for overexpression of the R109H mutant was obtained by site-directed mutagenesis of plasmid pET28bRho (kindly provided by Pr. James Berger, Johns Hopkins University) using the NEBuilder HiFi kit (New England Biolabs). The R109H mutant was overexpressed in BL21(DE3)pLysS cells carrying the pET28bR109H plasmid and purified as described for WT Rho 105.
-
bioRxiv - Microbiology 2024Quote: ... Libraries for Illumina sequencing (average insert size: 700 bp) were prepared using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs) and sequenced using Illumina MiSeq to generate 300 bp paired-end reads ...
-
bioRxiv - Molecular Biology 2024Quote: ... were PCR-amplified and subcloned into the Halo pcDNA5/FRT vector using Gibson Assembly Cloning Kit [New England Biotechnologies (NEB)] ...
-
Spatial visualization of A-to-I Editing in cells using Endonuclease V Immunostaining Assay (EndoVIA)bioRxiv - Molecular Biology 2024Quote: ... Cells were lysed and total RNA was isolated and purified using the Monarch Total RNA Miniprep Kit (New England BioLabs). This purified RNA was then used to prepare sequencing libraries with the Tru-Seq Stranded with RiboZero Gold (Human/Mouse/Rat ...
-
bioRxiv - Molecular Biology 2024Quote: ... the UGI in pYPQ265E2 was replaced by 2xUGI using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs®) to generate A3A-Y130F-nzCas9-2xUGI ...
-
bioRxiv - Molecular Biology 2024Quote: ... digested by NheI and BamHI were jointed together with 15-20 bp overlapping sequences using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB).
-
bioRxiv - Genetics 2024Quote: Libraries for whole genome sequencing (WGS) were prepared according to the previously described scMDA protocol using a NEBNext Ultra II FS kit (NEB). For quality control purposes ...
-
bioRxiv - Developmental Biology 2024Quote: ... Barcoded libraries were made with NEBNext Ultra II DNA Library Prep Kit for Illumina) using NEBNext Multiplex Oligos Dual Index Primers for Illumina (New England BioLabs) and sequenced on NextSeq2K (Illumina ...
-
bioRxiv - Neuroscience 2024Quote: ... were generated from a pENTR cyfip2-EGFP plasmid [32] using custom primers and the Q5 Site Directed Mutagenesis Kit (NEB) to induce the desired C179R (ΔRac1 ...
-
bioRxiv - Neuroscience 2024Quote: ... a V5 tag was inserted after the start codon of Ten-m cDNA (isoform B) in the plasmid pUAST-attB-Ten-m5 using the Q5 site-directed mutagenesis kit (New England Biolabs). To generate the UAS-V5-Ten-m-ΔICD and UAS-V5-Ten-m-ΔECD constructs ...
-
bioRxiv - Neuroscience 2024Quote: ... Silent mutations were introduced at the PAM site of the HDR vector by using the Q5 site-directed mutagenesis kit (New England Biolabs). The APEX2-V5-Ten-m HDR and the Ten-m gRNA vectors were co-injected into vas-Cas9124 fly embryos by BestGene ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthesized from 500ng RNA using a Multiscribe High Capacity cDNA Synthesis kit (Thermo) and qPCR was performed using Luna qPCR Master Mix (New England Biolabs) against primers listed in table 2.
-
bioRxiv - Microbiology 2024Quote: Amino acids substitutions in ompT were generated using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA). Briefly ...
-
bioRxiv - Microbiology 2024Quote: ... PolyA+ RNA was purified from ∼100 ng of total RNA and sequencing libraries were prepared with the NEBNext Ultra II RNA library kit (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: Quantification of SARS-CoV-2 E gene subgenomic mRNA (sgmRNA) was conducted using Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a Step One Plus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... The scFv DNA (256 ng) was ligated into the phagemid vector (400 ng) using the T4 Ligase Kit (New England BioLabs) in 25 × 40 μl reactions and incubated at 16°C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... aeruginosa riboPOOLs rRNA Depletion Kit (siTOOLs Biotech) followed by library preparation with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). The sequencing was performed at the Center for Cancer Research (CCR ...
-
bioRxiv - Microbiology 2024Quote: ... On-bead PCR indexing-amplification was performed using custom-ordered indexing primers (IDT) matching the Illumina Nextera Index Kit sequences and 2x Phusion Master Mix (NEB). PCR reactions were amplified for 9-11 cycles ...
-
bioRxiv - Microbiology 2024Quote: To test the binding affinity of the TBT and TBTG mRNA to the 30S ribosomal subunit we used PURExpress ΔRibosome Kit (NEB) supplemented with 5 μM of 30S ribosomal subunit and 10 μM tRNAfMet in the presence of 1.4 μM of radioactively labelled mRNA (prepared as described above by in vitro translation followed by [32P] labelling as described for the northern blot probe labelling) ...
-
bioRxiv - Microbiology 2024Quote: ... Genes of interest were PCR amplified to include either their native or heterologous promoter and cloned using Gibson Assembly kit (NEB) into integration vectors pDG1662 (for insertion into the amyE locus) ...
-
bioRxiv - Cell Biology 2024Quote: THP-1 monocytes were harvested and lysed for RNA extraction using the Monarch Total RNA Miniprep kit (New England Biolabs), according to the manufacturer protocol ...
-
bioRxiv - Developmental Biology 2024Quote: Reporter gene fusions for cis-regulatory analysis were made using either PCR fusion or Gibson Assembly Cloning Kit (NEB #5510S) 88 ...
-
bioRxiv - Cell Biology 2024Quote: ... Library preparation was slightly different and performed using the NEBNext® rRNA Depletion kit and protocol (NEB; P/N: E7850X) per manufacturer recommendations ...
-
bioRxiv - Biophysics 2024Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 ◦C for 5 min and 60 ◦C for 5 min ...
-
bioRxiv - Biophysics 2023Quote: ... all KIF5B mutations and truncations were made through substitution with gene fragments from IDT via HIFI DNA assembly kit (NEB) in a KIF5B mammalian expression vector ...
-
bioRxiv - Biophysics 2023Quote: ... The full length KIF5B in pACEBac1 was replaced with a C-terminal TEV-Twin-Strep-tag via HIFI DNA assembly kit (NEB). The TRAK1 construct was made through assembling His-ZZ-TEV-SNAP tag and TRAK1(1-395 ...
-
bioRxiv - Plant Biology 2023Quote: ... EM-seq libraries were prepared from sheared DNA using an enzymatic methyl-seq kit following the standard instructions (New England BioLabs), and were subjected to NextSeq550 using 75bp paired-end sequencing ...
-
bioRxiv - Biochemistry 2023Quote: ... and cloned into BamHI- and XhoI-digested pcDNA5/FRT vector using the NEBuilder HiFi DNA Assembly kit (New England Biolabs). The resultant construct ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA of the best quality from three replicates of each experiment were used for preparation of cDNA libraries for NGS using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... 50μl of sample was used for library preparation with the NEB Ultra DNA library kit (New England Biolabs, cat# E7370S). Barcoded samples were sequenced with a NextSeq500 2x150bp high output run ...
-
bioRxiv - Plant Biology 2023Quote: ... Chemical fragmentation of ligated RNA to ≤200nt was performed using the Magnesium RNA fragmentation kit (New England Biolabs, cat#E6150S). 2ul RNA Fragmentation Buffer was added and samples were incubated at 94°C for 5 minutes followed by a transfer to ice and the addition of 2μl of RNA Stop solution ...
-
bioRxiv - Developmental Biology 2024Quote: ... Complementary DNA (cDNA) was prepared from total RNA (5 μg) by reverse transcription using LunaScript® RT SuperMix Kit (NEB). qPCR reactions were performed using Power SYBR Green Master Mix (Thermo ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was poly-A selected and RNA-Seq libraries were prepared using NEBNext Library Prep Kit for Illumina (NEB #E7760). A Miseq shallow sequencing run was performed after library preparation to balance the sample loading process on the deep sequencer ...
-
bioRxiv - Cell Biology 2024Quote: ... domain from pmEGFP-N1-R-MCD(+0.2) plasmid (kind gift from Dr. Gregory Jedd) and cloned into XLone-GFP plasmid using Gibson assembly kit (NEB, E2611S). Two days after nucleofection ...
-
bioRxiv - Physiology 2024Quote: ... mRNA Magnetic Isolation Module was followed by library preparation using the NEBNext Ultra II RNA Directional Library Prep Kit for Illumina (New England BioLabs). Single read sequencing took place on a NextSeq 2000 System (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... the entire region of pET15b-His-sdeA except for the region encoding 1-199 aa of SdeA was amplified with primers 2649/2712 and then the fragment was self-ligated with a Gibson assembly kit (New England Biolabs). For construction of pmGFP-sdeAΔDUB ...
-
bioRxiv - Neuroscience 2024Quote: ... DNA fragments were generated by PCR amplification and then fused with the backbones using NEBuilder HiFi DNA assembly kit (New England Biolabs). All plasmids were verified by sequencing (GeneWiz).
-
bioRxiv - Cell Biology 2024Quote: ... with primers BA3187/BA3188 and cloned into RSFDuet-1 using BamHI/EcoRI sites with the NEBuilder HiFi DNA Assembly kit (NEB) (Table S1) ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by the conversion of the remaining RNA into an Illumina sequencing library using the NEBNext Ultra Directional RNA Library Prep kit (New England Biolabs). Following library preparation ...
-
bioRxiv - Cell Biology 2024Quote: ... the RNA underwent quantification and quality assessment before library preparation using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) in accordance with the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Immunology 2024Quote: ... pUC57-mini plasmids harboring the WT or mutated coding sequence downstream of T7 promoter were first transcribed into mRNA using the HiScribe T7 ARCA mRNA Kit (New England BioLabs) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: N-linked glycans were enzymatically released from purified mouse THP using PNGase-F kit (catalog no P0709S, New England Biolabs). N-glycans were then purified from the reaction mixture containing denaturing buffer and de-N-glycosylated proteins by solid phase extraction method using Sep-Pak C18 (1 cc Vac-cartridges ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We generated a next-generation sequencing library using an NEB Ultra II DNA Library Prep kit (New England Biolabs, MA) with an Illumina-compatible y-adapter ...
-
bioRxiv - Genetics 2024Quote: ... The DNA fragments were blunt-ended and ligated to the Illumina index using the NEBNext Ultra II DNA Library Prep kit for Illumina (New England BioLabs). Libraries for next-generation sequencing were prepared and sequenced with a NovaSeq 6000 instrument (Illumina) ...