Labshake search
Citations for New England Biolabs :
7101 - 7150 of 9358 citations for Rat Leptin RIA kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... DNA libraries were prepared from extracted gDNA using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB). DNA was purified and size selected using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2023Quote: ... Then the enriched mRNA was sheared into short fragments using fragmentation buffer and reversely transcribed into cDNA by Next Ultra RNA Library Prep Kit for Illumina (NEB #7530 ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... RNA-Seq libraries were then prepared using the NEBNext® Ultra ™ II Directional RNA Library Prep Kit (NEB, E7760) total RNA with rRNA depletion protocol using 100 ng of input RNA ...
-
bioRxiv - Genetics 2023Quote: The site directed mutagenesis of the rbsD gene to introduce the stop codon and the mutated dsrA binding sites was carried out using the Q5 mutagenesis kit (New England Biolabs) and selection on kanamycin plates ...
-
bioRxiv - Genomics 2023Quote: ... Short read Illumina sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit for Illumina (New England Biolabs), and sequenced on an Illumina HiSeq 2500 ...
-
bioRxiv - Immunology 2023Quote: ... were purified using the QIAquick PCR purification kit and ligated into the appropriate linearized expression vectors using T4 DNA ligase (New England BioLabs) and incubated overnight at 16°C.
-
bioRxiv - Genomics 2023Quote: Small RNA libraries were prepared using the NEBnext small RNA library kit for Illumina (New England Biolabs, Cat. No E7330S), following the standard protocol with the following parameters ...
-
bioRxiv - Microbiology 2023Quote: ... enough to cover the whole genome (https://artic.network/ncov-2019) and the Q5 TaqPolymerase kit (New England Biolabs, Massachusetts, USA), as previously described [10] ...
-
bioRxiv - Cancer Biology 2023Quote: ... Next-generation sequencing libraries were prepared using the NEBNext® Enzymatic Methyl-seq Kit (New England Biolabs, cat. no. E7120). Libraries were sequenced using a NovaSeq 6000 device in paired-end sequencing mode 2x150 cycles.
-
bioRxiv - Immunology 2023Quote: ... Polyadenylated transcript enrichment and strand specific library preparation was completed using a NEBNext Ultra II mRNA kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: The cellular mRNA from THP-1 cells was reverse transcribed with oligo-dT primer through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs) after TRIzol (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: Epitope-tagged constructs using the GST tag or the 3X FLAG tag were generated using the HiFi DNA Assembly cloning kit (NEB). MntS was cloned into pGEX-6-1 and the GST-MntS fusion was subcloned into pKT25c such that the resulting plasmid lacked the T25 region ...
-
bioRxiv - Microbiology 2023Quote: The ΔmntP::mneA replacement strain was generated by cloning the KanR cassette from pKD4 next to the mneA gene in pJS4B using the HiFi DNA Assembly cloning kit (NEB) (41) ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve transcripts and viral RNA in the samples were reverse transcribed with a reverse E1 primer containing a nongenomic tag sequence74 5’-CAGACAGCACTCGTTCGTACAC-3’ through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). The (+ ...
-
bioRxiv - Microbiology 2023Quote: ... we transcribed T7 promoter-pre-Let7c 5’GCTCCUUGGUUUGCTUGUUGGTTGTUCUGTTUUCTCCCUGGGTGTUUCTCTUUU CCUTUCUUCCTUCTUCCTCUUCCCGGUTGCCCTATAGTGTGAGTCGTATTA 3’ and T7-promoter-pre-miR29a 5’ATAACCGATTTCAGATGGTGCTAGAAAATTATATTGACTCTGAACACCAAAAGAAA TCAGTCCCTATAGTGAGTCGTATTA3’ using the T7 high yield RNA synthesis kit (BioLabs) with α 32P UTP (Perkin Elmer ...
-
Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNAbioRxiv - Molecular Biology 2023Quote: ... The plasmid encoding ABE8e was modified to incorporate mutations in the adenine deaminase domain (V28R or R111S) using a Q5 Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... was expressed from a pRS316-YEGFP-Pho8TMD-Atg15C background plasmid16 by substituting the CtAtg15(73–475) region for the ScAtg15(50–520) region using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs). All of the constructs were sequenced to confirm their identities.
-
bioRxiv - Plant Biology 2023Quote: ... The reactions were completed in a final volume of 10 µl using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs), and relative gene expression analysis using the Livak method was per-formed 53 ...
-
bioRxiv - Genomics 2023Quote: ... RNA sequencing libraries were prepared by NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB catalogue number E7760S). Libraries were sequenced as 150 bp paired-end reads using a Novaseq 6000 ...
-
bioRxiv - Genomics 2023Quote: High molecular weight genomic DNA was extracted from freshly pelleted cells using the Monarch Genomic DNA Purification kit (New England Biolabs). Immediately after extraction ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA was eluted from the oligo-dT beads and fragmented by incubating with the First Strand Synthesis Reaction buffer and Random Primer Mix (2×) from the NEBNext Ultra II Directional Library Prep Kit for Illumina (#NEBE7760; New England Biolabs) for 15Lmin at 94°C ...
-
bioRxiv - Genomics 2023Quote: Directional poly(A)+ RNA-Seq libraries were prepared using 300 ng of DNase-treated RNA using the Poly (A) mRNA Magnetic Isolation Module and NEBNext Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... The pool was amplified by asymmetric PCR followed by being assembled into PRDA_550 vector to acquire the designed library through NEBridge® Golden Gate Assembly Kit (BsmBI-v2) (New England Biolabs). The assembled product was transformed into NEB® Stable Competent E ...
-
bioRxiv - Plant Biology 2023Quote: ... Frozen plant tissue was ground to a powder and RNA was extracted using Monarch ® Total RNA Miniprep kits (NEB), RNA integrity and concentration were assessed by agarose gels and a Nanodrop spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA libraries were generated using 1µg RNA with the magnetic mRNA isolation module and NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs). DNA library was amplified by PCR and quality was analyzed using the fragment analyzer (Advanced Analytical) ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Cell Biology 2023Quote: ... were made by non-overlapping mutagenesis following the procedure described in the Q5 site-directed mutagenesis kit (New England Biolabs), using the pSS393 as template and divergent primers ...
-
bioRxiv - Cell Biology 2023Quote: ... The pSS459 plasmid driving the expression of PHOP1-GFP-pch2-nes4A was derived from pSS393 by using the NEBuilder assembly kit (New England Biolabs) and a synthesized gBlock fragment (IDT ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the coding sequence of mCherry and eGFP sequence were linked into the pminiTol2 plasmid with a Gibson cloning kit (New England Biolabs) to generate pmini-eGFP-Lefty-Gdf1/3-like-mCherry construct ...
-
bioRxiv - Biochemistry 2022Quote: ... The resulting RNA was used to generate cDNA using the LunaScript®RT SuperMix Kit according to the manufacture’s protocol (New England Biolabs).
-
bioRxiv - Biochemistry 2023Quote: ... The products were purified using the Zymo Research kit and eluted with 6 uL water and 1 uL was electroporated into DH10B cells (NEB). Electroporated cells were recovered in 975 uL of LB and plated on LB agar containing carbenicillin (100 μg/ml ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 30 ng of methylated DNA was used to generate the NGS (Next-Generation Sequencing) library by using the NEBNext ULTRA DNA Library Prep Kit for Illumina (New England Biolabs) and the NEBNext Multiplex Oligos for Illumina (New England Biolabs ...
-
bioRxiv - Developmental Biology 2023Quote: ... an SP6 promoter was inserted upstream of the transcriptional start using Q5 Site-Directed Mutagenesis Kit (New England Biolabs, #E0554S). All plasmids were confirmed by sequencing.
-
bioRxiv - Biochemistry 2023Quote: ... DNA assembly was performed to join R7-DD and R9-DD to linearised the GFP-cBAK vector using the NEBuilder HiFi DNA assembly kit (NEB).
-
bioRxiv - Bioengineering 2023Quote: ... in vitro transcription (used in experiments in figures otherwise) from the SB100x plasmid using the HiScribe T7 ARCA mRNA (with tailing) Kit (NEB). Following RNA transcription in vitro ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... RNA library preparation was performed on total or polysomal RNA using a NEBNext Poly(A) mRNA Magnetic Isolation Module and a NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) according to the manufacturer’s instructions with 1 μg of RNA as a starting point ...
-
bioRxiv - Immunology 2023Quote: ... The following primers were used to amplify the Mpro sequence from cDNA with the Phusion polymerase kit (New England BioLabs). F:AATAAGGTACCAGTGGTTTTAGAAAAATGG ...
-
bioRxiv - Cancer Biology 2023Quote: ... The mutation for generating BN-CD38Mut was introduced to BN-CD38 with Q5 Site-Directed Mutagenesis kit (New England Biolabs). Both were produced transiently in ExpiCHO cells (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... Library construction: The RNA sequencing library was constructed using NEBNext® Ultra II RNA Library Prep Kit (New England Biolabs) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2022Quote: ... Non-directional sequencing libraries were completed with the “NEBNext Ultra II FS DNA Library Prep Kit for Illumina” (NEB #E7805) and subsequently analyzed on an Illumina NextSeq 550 with v2.5 reagent kits following manufacturer’s protocols.
-
bioRxiv - Cell Biology 2023Quote: ... was introduced into an existing pZDonor-AAVS1-CAG-HA-KLF1-ERT2-PolyA plasmid (28) via site-directed mutagenesis using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England BioLabs) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Purified DNA was submitted to NGS library preparation using NEBNext Ultra II DNA Library Prep Kit (New England BioLabs, E765) and sequenced with NovaSeq 6000 (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... Eluted DNA was used for qPCR or sequencing library preparation with NEBNext Ultra II DNA Library Prep Kit (NEB; E7645) according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2023Quote: ... beads was fragmented into short fragments using fragmentation buffer and reversly transcribed into cDNA by using NEBNext Ultra RNA Library Prep Kit for Illumina (#7530, New England Biolabs). The purified double-stranded cDNA fragments were end repaired ...
-
bioRxiv - Cell Biology 2022Quote: ... and CUT&RUN samples from two replicate (two independent CRISPRi clones) using NEBNext Ultra II DNA Library Prep Kit for Illumina (E7645, NEB). The manufacture’s protocol was employed with the following changes ...
-
bioRxiv - Biophysics 2023Quote: Illumina sequencing adapters were added by ligation mediated PCR using the NEBNext UltraII DNA Library Prep Kit (New England BioLabs). The libraries were Bioanalyzed on a high sensitivity DNA chip ...
-
bioRxiv - Cancer Biology 2023Quote: ... The ligation product was amplified through 10 reaction cycles to generate a whole genome library (MC library) using NEBNext Ultra II DNA library Prep Kit for Illumina (New England Biolabs) and 750ng MC library was used for exome enrichment ...
-
bioRxiv - Cancer Biology 2023Quote: ChIP-seq libraries were prepared using 2-5 ng of input and ChIP samples and the kit NEBNext Ultra DNA Library Prep for Illumina (New England Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng DNA was subjected to library preparation using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: PT024 RARα cells were treated as described and total RNA were extracted using Monarch Total RNA miniprep kit (NEB #T2010S) according to manufacturer’s protocol.