Labshake search
Citations for New England Biolabs :
6851 - 6900 of 7781 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... with and without the addition of ACE2 (~1:1.25 S-protein trimer:ACE2 molar ratio) (New England Biolabs). Vitrified samples of S-protein constructs with and without ACE2 were prepared by first glow discharging Quantifoil R1.2/1.3 300 mesh holey carbon copper grids for 1 minute using a Pelco easiGlow glow discharge unit (Ted Pella ...
-
bioRxiv - Biochemistry 2021Quote: Radiolabeling of oligonucleotides was carried out for 1 h at 37 °C using T4 polynucleotide kinase (NEB), 0.25 μM oligonucleotide ...
-
bioRxiv - Microbiology 2021Quote: ... then heat inactivated at 65°C for 30 minutes and ligated using 1 µl Quick Ligase (NEB) at room temperature for 15 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 μl of Protoscript II Reverse Transcriptase (200 U/μl, Catalog No. M0368, New England BioLabs Inc.), 2 μl of 0.1M dithiothreitol (DTT) ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µl from the supernatant was used for a 20 µl PCR reaction with Phusion polymerase (NEB), using primers oLGB21 (TGGGAGCAAGTTTTCTGAATTTGG ...
-
bioRxiv - Microbiology 2021Quote: ... and 10 μl of 2x Quick T4 ligase buffer and 1 μl Quick T4 DNA ligase (NEB) were added and incubated at room temperature overnight ...
-
bioRxiv - Plant Biology 2021Quote: The pGEX6P-1 vector (Cytiva, Tokyo, Japan) was digested with SalI-HF (New England Biolabs, Tokyo, Japan). Alleles of MvALS1/2/3/5 from the sensitive population (SMM13 ...
-
bioRxiv - Genomics 2020Quote: ... 50ng digested px330 was mixed with 1:250 diluted oligo duplex with 2X quick ligation buffer (NEB) and quick ligase (NEB ...
-
bioRxiv - Biophysics 2020Quote: 1 μg purified full length hGHR was incubated with 500 units of Endo-H (New Biolabs, USA) at 4 °C in 20 mM NaH2PO4/Na2HPO4 (pH 7.4) ...
-
bioRxiv - Microbiology 2022Quote: Ten μg of total DNA were digested with 1 μL of MmeI restriction enzyme (New England Biolabs) in 250 μL total volume with 10 μL of S-adenosyl methionine (SAM ...
-
bioRxiv - Microbiology 2022Quote: ... 10 min) and resuspended in 50 µl of 50 mM Tris-HCl containing 1 µg trypsin (NEB). After overnight incubation at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA were synthesised from 1 µg RNA by reverse transcription using LunaScript RT SuperMix Kit (NEB; E3010). qRT-PCR was performed using Luna Universal qPCR Master Mix (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... for 1 hr at 37°C and circularized with T4 DNA Ligase (New England Biolabs, MA, USA) overnight at room temperature using buffers and instructions provided by the manufacturer ...
-
bioRxiv - Neuroscience 2022Quote: ... with NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1) (E7600S, New England BioLabs) based on manufacture instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... for 1 h at 37°C into the PiggyBac recipient vector previously digested with BlpI (NEB #R0585S) and BstXI (NEB #R0113S ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA was extracted using TRIzol reagent (MRC, USA) and ligated with T4 RNA ligase 1 (NEB, USA) at 37 °C for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... 75 μg of plasmid p28-1::flgBp-aacC1 [34] were digested with AgeI-HF (New England Biolabs), ethanol precipitated [68] ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA (1 µg per sample) was transcribed to cDNA by the Protoscript®II reverse transcriptase (NEB). clpP ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were treated for 90 min with a 1:150 dilution of RNase III (New England Biolabs) in low-salt buffer (50 mM Tris-HCl pH 7.6 ...
-
bioRxiv - Biophysics 2023Quote: ... The clarified and filtered lysate was loaded on 1 mL of IgG Sepharose fast flow resin (NEB). The column was washed with lysis buffer and TEV cleavage buffer (lysis buffer with 75 mM NaCl ...
-
bioRxiv - Cell Biology 2023Quote: ... 1-cell stage embryos were injected with two guides for each gene with Cas9 protein (NEB, M0646T). Tyrosinase was an injection control to validate the efficacy of the Cas9 protein ...
-
bioRxiv - Biochemistry 2023Quote: ... 17 μl of the lysates was treated with 1 μl of Deglycosylation mix II (NEB, cat# P6044S) or distilled water ...
-
bioRxiv - Genetics 2022Quote: ... using the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (New England Biolabs, Ipswich, MA). Paired-end 300 bp reads were generated on an Illumina MiSeq.
-
bioRxiv - Genetics 2023Quote: ... and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs Index Primers Set 1; NEB, E7335S). Samples were pooled and submitted to MSKCC Integrated Genomics Operation core for quality control and sequencing on Illumina HiSeq 4000 platform.
-
bioRxiv - Genetics 2023Quote: ... and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs Index Primers Set 1; NEB, E7335S). Samples were pooled and submitted to MSKCC Integrated Genomics Operation core for quality control and sequencing on Illumina HiSeq 4000 platform.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized from 1 µg of total RNA using the LunaScript RT SuperMix kit (NEB, UK) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... A first round of PCR was performed using 1× Standard-Taq magnesium free reaction buffer pack (NEB) with 2 mM MgCl2 (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... then combined and treated with 1% SDS and 20 µg of proteinase K (New England Biolabs, #P8107S). The reaction was incubated for 1 h at 55°C ...
-
bioRxiv - Genomics 2023Quote: ... 1 μl of Hia5 MTase (200 U)19 and 1.5 μl 32 mM S-adenosylmethionine (NEB B9003S) (0.8 mM final concentration ...
-
bioRxiv - Biochemistry 2023Quote: ... Bound protein was detected by western blot using mouse anti-MBP diluted 1:10,000 (New England Biolabs), fluorescent secondary antibodies (Li-Cor Biosciences) ...
-
bioRxiv - Genetics 2023Quote: ... Total RNA (1 µg) was reverse transcribed using ProtoScript II First Strand cDNA Synthesis Kit (NEB, E6560S) with primer UP0118 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs Index Primers Set 1; NEB, E7335S). Samples were pooled and submitted to MSKCC Integrated Genomics Operation core for quality control and sequencing on Illumina HiSeq 4000 platform.
-
bioRxiv - Developmental Biology 2023Quote: ... and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs Index Primers Set 1; NEB, E7335S). Samples were pooled and submitted to MSKCC Integrated Genomics Operation core for quality control and sequencing on Illumina HiSeq 4000 platform.
-
bioRxiv - Molecular Biology 2023Quote: ... the GFP RNA was linked to the treated linker with T4 RNA ligase 1 (New England Biolabs). The obtained RNA was purified with the Monarch RNA purification kit (New England Biolabs) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... equimolar concentrations of the vectors were mixed with 1 µL I-SceI restriction enzyme (New England Biolabs) and 1 µL CutSmart buffer (10x ...
-
bioRxiv - Cell Biology 2023Quote: ... Receptors were surface labeled by addition of SNAP-Surface Alexa Fluor 546 (1:1000, New England Biolabs) to DMEM F12 without serum and phenol red (21041-025 ...
-
bioRxiv - Neuroscience 2023Quote: ... 72°C – 1 min]) with NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs, #M0541S) and barcoded Nextera primers (1.25 μM each ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μg RCA product was restricted by employing 10 U nicking endonuclease Nb.BbvCI (New England Biolabs, R0631L) in a 50 μL reaction volume with 1x rCutsmart buffer for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... 20 uL of sheared DNA was then digested with 1 U of DpnI in cutsmart buffer (NEB) for 3 hours at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was reverse transcribed from 1 µg of total RNA using LunaScript RT Supermix kit (NEB #E3010) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and libraries prepared using NEBNext Multiplex Oligos for Illumina Index Primer Set 1 (New England Biolabs, E7335S) and NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... The phages were then treated with 100 μg·ml-1 of Proteinase K (New England Biolabs, Whitby, Canada) with SDS to a final concentration of 2% (v·v-1 ...
-
Cellular sialoglycans are differentially required for endosomal and cell-surface entry of SARS-CoV-2bioRxiv - Microbiology 2024Quote: ... followed by a secondary Alexa Fluor 555 conjugated anti-mouse IgG antibody (NEB #4413S; diluted 1:1000). For flow cytometry ...
-
bioRxiv - Genetics 2024Quote: ... PCR samples were combined with 1 μL of 6X gel loading dye (New England Biolabs, Cat. # B7024S) per 5 μL of sample and loaded each the remaining wells ...
-
The triad interaction of ULK1, ATG13, and FIP200 is required for ULK complex formation and autophagybioRxiv - Cell Biology 2024Quote: ... MBP-FIP200 (1–634) was purified by affinity chromatography using Amylose Resin High Flow (New England Biolabs). Next ...
-
bioRxiv - Microbiology 2024Quote: ... A polyC tail was added to 1 µg of end repaired DNA using Terminal Deoxynucleotidyl Transferase (NEB) with a mixture of 95% dCTP and 5% ddCTP as a substrate ...
-
bioRxiv - Microbiology 2024Quote: ... using a specific primer pair (Supplementary table 1) and Q5 High-Fidelity DNA Polymerase (New England Biolabs). The PCR product was purified using a MinElute Reaction Cleanup kit (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... The 1 kb regions were assembled into the suicide plasmid pK18mobsacB72 using Gibson Assembly73 (New England Biolabs) and the resulting pK18-Δbd2269 was transformed into E ...
-
bioRxiv - Plant Biology 2024Quote: ... the MBP tag was enzymatically cleaved using 10 μg ml-1 Xa factor protease (NEB, Cat#P8010) at 23°C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... 30 µL of RNA was premixed with 1 µL of 200 ng/µL Random Primer 9 (NEB) and 2 µL 100 mM dNTPs (NEB ...