Labshake search
Citations for New England Biolabs :
6501 - 6550 of 9547 citations for QuantiChrom Phosphate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Isolated mRNA was used to generate dual-indexed cDNA libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Eight cycles of PCR amplification were applied to all the libraries ...
-
bioRxiv - Cell Biology 2022Quote: ... All the point mutations in the recombinant LC3B and GABARAP were generated by Q5 Site-Directed Mutagenesis Kit (New England BioLabs). pGEX-6P1-GST-ATG3 was a gift from Dr ...
-
bioRxiv - Biochemistry 2022Quote: ... and cloned in the EcoRV and BamHI restriction site of the pBBR1MCS-2 (55) using the NEBuilder Assembly kit (New England BioLabs). pBBR1MCS-2 was a gift from Kenneth Peterson (Addgene plasmid # 85168 ...
-
bioRxiv - Genomics 2022Quote: ... The libraries were prepared from 200ng of input DNA with control DNA (CpG methylated pUC19 and CpG unmethylated lambda DNA) using NEBNext Enzymatic Methylation-seq kit (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... A total amount of 1 μg of RNA per sample was used to prepare cDNA libraries generated using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2022Quote: Fragmentasion and adaptor ligation were performed using 10-20ng of second-PCR product as a template with NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs) with some modifications ...
-
bioRxiv - Cell Biology 2022Quote: ... EGFP-Sec22b-shR and EGFP-Sec22b-P33-shR were generated by site-directed mutagenesis (F: CTTCTGAATGAAGGTGTCGAACTCGATAAAAGAATAAGGCCTAGACACAGTGGGC; R: GCCCACTGTGTCTAGGCCTTATTCTTTTATCGAGTTCGACACCTTCATTCAGAAG) using the Q5 Site-Directed Mutagenesis Kit (NEB). pEGFP-ORP8-H514A-H515A (ORP8-Mut ...
-
bioRxiv - Cancer Biology 2022Quote: ... A minimum of 1 μg (20 ng/μl) of high-quality total RNA (extracted using Monarch Total RNA Miniprep Kit, NEB) was supplied for sequencing ...
-
bioRxiv - Developmental Biology 2022Quote: ... Library preparation was performed using the NEBNext Ultra II DNA Library Prep Kit (E7805S, New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... was generated by the assembly of 5 DNA fragments using the NEBuilder HiFi DNA assembly cloning kit (New England Biolabs). These DNA fragments ...
-
bioRxiv - Cell Biology 2022Quote: ... 400 ng to 1 μg of input RNA was used as a template for reverse transcription using Protoscript II First Strand cDNA Synthesis Kit (NEB) and random hexamers ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μg of total RNA was used as an input material for library preparation using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina with NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). The libraries were multiplexed and paired-end sequenced (2 × 75 bp ...
-
bioRxiv - Cell Biology 2022Quote: ... Mutations in the sgRNA target site of the plasmid were introduced and neomycin was removed using Q5 Site-Directed Mutagenesis Kit (#E0554S, New England Biolabs).
-
bioRxiv - Plant Biology 2021Quote: ... 2389–4785 nt and 4786–4914 nt) were assembled into the pASW vector using NEBuilder Hifi DNA Assembly kit (NEB).
-
bioRxiv - Neuroscience 2020Quote: ... libraries were prepared in an additional 15 amplification cycles using the NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs) and sequenced on the HiSeq2000 platform (Illumina ...
-
bioRxiv - Microbiology 2020Quote: Genomic libraries were created using the NEBNext® Ultra DNA library Prep Kit for Illumina sequencing (New England Biolabs, US) and genomes were sequenced on an Illumina MiSeq v2 500 (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: ... Libraries were prepared according to NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, U.S.A.) followed by single end sequencing on a HiSeq3000 to produce 2-3 Gb data per sample ...
-
bioRxiv - Microbiology 2020Quote: ... RNA sequencing libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (New England BioLabs; Ipswich, MA, USA) and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Immunology 2020Quote: ... all DNA precipitated from pA-MN digestion was used for library preparation using NEBNext Ultra II DNA Library Prep Kit (NEB). The adaptor was diluted to 1:25 for adaptor ligation ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA copies were quantified in 10% of the obtained eluate volume with a one-step RT-qPCR reaction using a standard curve and the Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs) and previously published TaqMan primers and probe (Corman et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Library quality was assessed using an Agilent Tapestation 4200 instrument and quantity determined by qPCR using an NEBnext library quantification kit (NEB). Libraries were sequenced as described previously (43 ...
-
bioRxiv - Microbiology 2021Quote: A plasmid was created for each gene of interest (GOI) using the modified pSAG plasmid template and the Q5 Site-Directed Mutagenesis Kit (NEB) by following the manufacturer’s protocol with a few adaptations ...
-
bioRxiv - Developmental Biology 2021Quote: ... Reaction products were used as a template for the in vitro transcription (HiScribe T7 High Yield RNA Synthesis Kit, England Biolabs) and purified ...
-
bioRxiv - Microbiology 2021Quote: ... Amplification-free indexed Illumina libraries were prepared (9) using the NEBNext Ultra II DNA Library Prep kit (New England BioLabs). The libraries were quantified using the Accuclear Ultra High Sensitivity dsDNA Quantitative kit (Biotium ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina in combination with the Poly(A) mRNA Magnetic Isolation Module (#E7760, #E7490, NEB) was used ...
-
bioRxiv - Molecular Biology 2020Quote: ... and sequencing libraries were prepared using the NEB ULTRA kit following manufacturer’s instructions for genomic DNA library construction and using methylated adaptors (NEB E7535S). Adaptor-ligated DNA was isolated by 2% agarose gel electrophoresis (350–400 bp) ...
-
bioRxiv - Molecular Biology 2020Quote: ... were engineered to lack the guide sequence and were assembled from PCR products by Gibson assembly (Gibson Assembly Master Mix kit, New England Biolabs).
-
bioRxiv - Molecular Biology 2019Quote: ... DNA libraries were generated using 1µg RNA with the magnetic mRNA isolation module and NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs). DNA library was amplified by 7 PCR cycles and quality was analyzed using the fragment analyzer (Advanced Analytical) ...
-
bioRxiv - Plant Biology 2021Quote: ... 135-160 and 161-206 aa were deleted from the BD-AtCGL160 vector using a site-directed mutagenesis kit (NEB). Primers are listed in Supplemental Table S2 ...
-
bioRxiv - Neuroscience 2020Quote: Illumina compatible libraries were produced from 1250ng total RNA using NEBNext Ultra II RNA Library Prep Kit (NEB Cat#E7770S) following manufactures protocol with the following modifications ...
-
bioRxiv - Genomics 2020Quote: ... We added Illumina TruSeq adaptors using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs: E7645) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... Point mutations (K66E and K166A) on F-BAR-EGFP were produced by the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). Identity of plasmids was confirmed by Sanger sequencing.
-
bioRxiv - Microbiology 2021Quote: ... Fragments between ∼1 kb and ∼8 kb were size selected by excision with a clean razor blade and DNA was purified from the agarose by a silica column-based gel extraction kit (New England Biolabs, cat#T1020S ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR product was then cloned into pTH19 linearized with BamHI and HindIII using the NEBbuilder assembly kit (New England Biolabs). The plasmid was transformed into yeast as described previously 71 selecting for transformants on media lacking uracil.
-
bioRxiv - Neuroscience 2021Quote: ... The coding sequence of GluN2A and GluN2B point mutations for sgRNA resistant plasmid (GluN2A: AGCCACGACGTGACAGAACGCGAACTT to AGTCACGACGTGACTGAGAGAGAACTT; GluN2B: ATGTCTGACCGGAAGATCCAGGGG to ATGTCTGATCGTAAGATTCAAGGA) were generated by Q5 Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Microbiology 2020Quote: ... The resulting fragment was cloned into the BamHI-NcoI sites of plasmid pGFP-phleo using the NEBuilder DNA assembly kit (New England Biolabs). In this plasmid ...
-
bioRxiv - Neuroscience 2021Quote: ... Whole DG libraries for bulk RNAseq were generated with the NEBNext Ultra II Directional RNA Library prep kit (New England Biolabs). The Clontech SMART-Seq HT (Takara ...
-
bioRxiv - Microbiology 2020Quote: ... Library preparation for Illumina sequencing was performed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs) and a minimum of 5 ng of RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... and the product was inserted into a lentiviral expression vector (pSIH-H1) containing CMV promotor using NEBbuilder HIFI kit (NEW ENGLAND Biolabs). To co-express GFP-actin and mCherry-KDEL ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified then assembled with pMQ30MRR1-L1191H+Q1197* (linearized with PvuI-HF) using the NEBuilder HiFi DNA Assembly cloning kit (New England BioLabs). To remove an unexpected nonsynonymous mutation in pMQ30MRR1-Q1197* ...
-
bioRxiv - Microbiology 2020Quote: ... using HiScribe T7 Quick High Yield RNA Synthesis Kit according to the manufacturer’s protocol (New England BioLabs Inc, NEB #E2050). The amplified RNA was than purified using Monarch RNA Cleanup Kit (New England BioLabs Inc. ...
-
bioRxiv - Microbiology 2020Quote: ... A C-terminal V5-tag was added and the construct was subcloned into the pCAGGS vector using the NEBuilder HiFi DNA Assembly kit (New England Biolabs). Likewise ...
-
bioRxiv - Microbiology 2020Quote: DNA probes were synthesized via PCR with Q5 high-fidelity polymerase (Thermo) and purified with Monarch PCR Cleanup Kit (NEB). 75ng probe A/probe B and 150ng probe C/probe D were added to increasing concentrations of protein (4% ...
-
bioRxiv - Microbiology 2020Quote: The SARS2-CoV-2 vaccine candidates were cloned by combining the S cDNA (obtained after PCR on overlapping synthetic cDNA fragments; IDT) by a NEB Builder Cloning kit (New England Biolabs) into the pShuttle-YF17D backbone ...
-
bioRxiv - Neuroscience 2021Quote: ... The Drosophila G269E and I307N mutations were generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Ipswitch, MA). Mutagenesis primers were designed using the “substitution” feature in NEBaseChanger v1.2.9 (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: ... NA and NP RNA were synthesized using a HiScribe T7 in vitro transcription kit (New England BioLabs, Ipswich, MA, USA) and incubated with 3D8 scFv purified protein (0.5 μg ...
-
bioRxiv - Molecular Biology 2020Quote: ... The sheared genomic DNA was prepared for sequencing using a NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs) with an additional PCR step to amplify for transposon containing fragments ...
-
bioRxiv - Molecular Biology 2020Quote: ... The resulting amplicons from each replicate/strain were cleaned up using the Monarch PCR & DNA Cleanup kit (New England Biolabs). Next ...
-
bioRxiv - Neuroscience 2021Quote: ... Mutations identified in EA6 patients were introduced into hEAAT1 plasmid DNA using Q5 site-directed mutagenesis kit (New England Biolabs). Purified plasmid DNAs were sequenced using Big Dye Terminator (BDT ...
-
bioRxiv - Neuroscience 2021Quote: ... Strand-specific RNASeq libraries were created using the NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB #6420L ...