Labshake search
Citations for New England Biolabs :
6151 - 6200 of 6282 citations for 6 Quinolinamine 1 ethyl 1 2 3 4 tetrahydro 2 2 4 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... mRNA was purified and enriched from 1 µg of total RNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, catalog no. E7490L). RNA fragmentation ...
-
bioRxiv - Cell Biology 2022Quote: ... Halt™ Protease and Phosphatase Inhibitor Cocktail in 1X PBS) and then washed twice with either 11 dephosphorylation buffer (1 mM MnCl2, 1X PMP buffer, New England Biolabs, P0753, protease inhibitors) or CN dephosphorylation buffer (50 mM Tris-HCl pH 8 ...
-
bioRxiv - Molecular Biology 2020Quote: ... GAL4-Creb5(1-128)T59/T61A and GAL4-Creb5(1-128)C18/C23S were generated by inducing point mutations in the GAL4-Creb5(1-128) vector using the Q5® Site-Directed Mutagenesis Kit (NEB, Cat#: E0554S). The control vector GAL4(1-147 ...
-
bioRxiv - Genetics 2020Quote: ... The PCR products were run on a 1% agarose gel stained with ethidium bromide alongside a 100 bp ladder (New England Biolabs, Ipswitch, MA, USA).
-
bioRxiv - Biochemistry 2020Quote: ... The PCR amplification was performed with 10 µl of the reverse transcriptase product in a 50 µl PCR mix containing 1 unit of Phusion High-Fidelity DNA polymerase (New England Biolabs, Évry-Courcouronnes, France), 1X HF Phusion buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... fraction #2 of all samples as well as a positive control of U1 snRNP were incubated with 1 μl of proteinase K (NEB, 800 units/ml) for 30 min at 37 °C and loaded onto a denaturing gel (8% acrylamide/bis-acrylamide ...
-
bioRxiv - Pathology 2021Quote: ... The DNA fragment encoding the desired FLAG-TEV tag was generated via PCR using primer pair 2 (table 1) and subsequently cloned into the NdeI restriction site of pET24Δlac/Ep-CoV2 using NEBuilder® HiFi DNA Assembly (NEB, Ipswich, MA, USA).
-
bioRxiv - Genomics 2020Quote: ... genomic DNA libraries were constructed for sequencing on Illumina platforms using the NEBNext® DNA Sample Prep Master Mix Set 1 (New England Biolabs, Ipswich, MA). First ...
-
bioRxiv - Genomics 2019Quote: ... The microRNA-Seq library was constructed using NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) following the instructions provided by the manufacturer (NEB, E7300S/L, USA). The library construction was started with 800ng total RNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... Libraries were prepared from 1 μg of total RNA using the NEB Next Multiplex Small RNA Library Prep Set for Illumina (NEB #E7300S and #E7580S) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... with rotation for 1 hour at room temperature followed by further incubation for 1 hour with the addition of 15 μl of goat anti-mouse IgG magnetic beads (New England Biolabs, Ipswich, MA, USA). The magnetic beads in the supernatant were collected on a magnetic stand and washed 2 times with PBS ...
-
bioRxiv - Microbiology 2021Quote: ... The transcription levels of the HO-1 gene were detected using the Luna Universal qPCR Master Mix (New England Biolabs Japan, Tokyo, Japan). Real-time PCR was performed using Mastercycler ep realplex2 (Eppendorf ...
-
bioRxiv - Genomics 2021Quote: ... gDNA was extracted from 1 ml of overnight culture with the kit Monarch HMW DNA Extraction kit (T#3060 New England Biolabs; Ipswich, MA, USA) following the manufacturer instructions for High Molecular Weight DNA extraction from gram-negative bacteria ...
-
bioRxiv - Physiology 2022Quote: ... The single stranded cDNA was ligated with a partial Illumina 5’ adaptor (HZG885:/5phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTddC) using T4 RNA ligase 1 (New England Biolabs, Ipswich, MA, US) and incubated overnight at 22 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fixed cells were resuspended in 1 mL spheroplast buffer (1.2 M sorbitol, 0.1 M potassium phosphate, 20 mM vanadyl ribonuclease complex [NEB S1402S], 20 µM beta-mercaptoethanol), and 1.2–5 µL 100T zymolyase (US Biological Z1005 ...
-
bioRxiv - Bioengineering 2022Quote: ... and mRNA was isolated from ∼1 μg of total RNA using NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB, Cat. No. / ID: E7490). RNA-seq libraries were constructed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Evolutionary Biology 2024Quote: We prepared dual indexed libraries according to the instruction manual using the NEBNext Ultra II DNA Library Prep Kit for Illumina and the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1, New England Biolabs, Ipswich, Massachusetts, USA) and following the recommended conditions of bead-based size selection according to distribution of DNA fragments per sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... we dispensed 5 μL of a sense oligo and then added 40 μL of phosphorylation reaction mix containing 1 μL of T4 Polynucleotide Kinase (PNK; NEB, cat. no. M0201S), 5 μL of T4 PNK buffer (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... 0.5 – 1 μg DNA template were in vitro transcribed using HiScribe® T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA), following manufacturer’s instruction ...
-
Dual RNA-seq identifies proteins and pathways modulated during Clostridioides difficile colonisationbioRxiv - Microbiology 2023Quote: ... The NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® with the NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1) were used to generate DNA libraries for sequencing (New England Biolabs, USA) as per the manufacturers protocol ...
-
bioRxiv - Genomics 2023Quote: ... The cDNA libraries were constructed from 1 ug input RNA using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB), following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... Adaptor ligation was performed with 1:25 diluted adaptor and 15 cycles were used for library amplification using dual indices (NEB dual index kit). Paired-end 2×25 bp sequencing was performed on a NextSeq500 Illumina Sequencer.
-
bioRxiv - Genetics 2023Quote: ... 1 μg of RNA was used to generate sequencing libraries using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following polyA selection ...
-
bioRxiv - Bioengineering 2023Quote: ... and mRNA was isolated from ∼1 μg of total RNA using NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB, Cat. No. / ID: E7490). RNA-seq libraries were constructed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Genomics 2023Quote: ... and single colonies were picked 1 day later to grow up and extract plasmid DNA using a Monarch Plasmid Miniprep Kit (New England Biolabs, Cat. No. T1010L). Extracted plasmid DNA was sequence confirmed via long-read Nanopore sequencing (Primordium Labs ...
-
bioRxiv - Cell Biology 2022Quote: ... 15 μL of cell lysate was further treated for 1 h at 37°C with 40 units of Quick calf intestinal alkaline phosphatase (CIP, New England Biolabs, Ipswich, MA, USA) per the manufacturer’s recommendations ...
-
HTLV-1 Splice Sites in Prevalent Gene Vectors Cause Splicing Perturbations in Transgenic Human CellsbioRxiv - Genomics 2023Quote: ... Following magnetic bead purification one third of the cDNA per sample was subjected to PCR amplifications with the primers HTLV-1 and PE-2nd-GA using the NEBNext® Ultra™ II Q5® Master Mix (NEB) using the cycling program ...
-
bioRxiv - Genomics 2023Quote: ... We purified and enriched mRNA from 1 ug of total RNA using the NEBNext Poly(A) Magnetic Isolation Module (New England Biolabs, catalog no. E7490L). RNA fragmentation ...
-
bioRxiv - Molecular Biology 2023Quote: 1 µg of total RNA was used to perform mRNA isolation using NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB Cat. No. E7490). The resulting mRNA material was used to prepare the libraries with the use of NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... The sequencing libraries were prepared following Chapter 1 of the NEB® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England BioLabs, NEB) protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Adaptor ligation was performed with 1:25 diluted adaptor and 15 cycles were used for library amplification using dual indices (NEB dual index kit). Paired-end 2×25 bp sequencing was performed on a NextSeq500 Illumina Sequencer.
-
bioRxiv - Bioengineering 2023Quote: ... The DNA fragments encoding enriched peptide genes were mixed with sfGFP gene portion and assembled by 1 hour incubation at 50°C using HiFi Master mix (NEB Japan, Tokyo, Japan). The reaction mixture was then used in PCR amplification with primers 13 and 14 to obtain peptide-sfGFP gene fragments suitable for cell-free protein synthesis ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA library was PCR amplified using KAPA HiFi HotStart ReadyMix (FisherScientific, 50-196-5217) and NEBNext® Multiplex Oligos for Illumina® Dual Index Primers Set 1 (NEB, E7600S). The library was purified twice using 1x AMPure XP Bead (BeckmanCoulter ...
-
bioRxiv - Cancer Biology 2023Quote: ... The library was PCR amplified using KAPA HiFi HotStart ReadyMix (FisherScientific, 50-196-5217) and NEBNext® Multiplex Oligos for Illumina® Dual Index Primers Set 1 (NEB, E7600S). The library was purified twice using 1x AMPure XP Bead (BeckmanCoulter ...
-
bioRxiv - Genomics 2023Quote: ... We then ligated barcodes to the end-prepped DNA using the Native Barcoding Expansion 1–12 kit (EXP-NBD104, Oxford Nanopore Technologies, Oxford, UK) and Blunt/TA Ligase Master Mix (New England Biolabs, Ipswich, MA, USA). We cleaned the barcoded samples using 0.9X AMPure XP beads ...
-
bioRxiv - Genomics 2023Quote: ... using the Adapter Mix II from the Native Barcoding Expansion 1–12 kit and NEBNext Quick Ligation Reaction Buffer (New England Biolabs, Ipswich, MA, USA) as well as Quick T4 DNA Ligase (New England Biolabs ...
-
bioRxiv - Bioengineering 2024Quote: ... along with a well containing 10 µl Quick-Load® Purple 1 kb DNA Ladder (New England Biolabs catalog no. N0552S; New England BioLabs, Ipswich, MA) and ran at 105 V for 45 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... ChIP-seq libraries were prepared from 3-5ng ChIPed DNA using NEBNext® Ultra™ II DNA Library Prep Kit (NEB, E7645S), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... A 3’ 3x FLAG tag was then inserted by site directed mutagenesis using a Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) and the primers PPARGC1A_FLAG_SDM_F and PPARGC1A_FLAG_SDM_R (see Supplementary Table 1) ...
-
bioRxiv - Systems Biology 2022Quote: The small RNA sequencing libraries were constructed using 3 μg total RNA per sample and NEB Next® Multiplex Small RNA Library Prep Set for Illumina® (NEB) following the manufacturer’s recommendation ...
-
bioRxiv - Genomics 2022Quote: ... to 5 μg of input DNA (in total volume of 24 μl at >210 ng/μl) with 3 μl 10X CutSmart Buffer (NEB, Cat #B7204), and incubating for 10 min at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and then enriched via PCR amplification in a total volume of 50 μL containing 3 μL of NEB Next USER Enzyme (NEB, Ipswich, USA), 25 μL of NEB Next High-Fidelity PCR Master Mix (2× ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Genomics 2019Quote: ... 3 µg of dam-dcm- plasmid DNA in a 50 µl reaction containing 20 U of M.SssI methylase (NEB, Ipswich MA, USA), 1X NEBuffer 2 ...
-
bioRxiv - Genetics 2021Quote: ... DNA fragments with A-3’ end overhangs were then ligated to the DS adaptors with T-3’ overhangs using the NEBNext® Ultra™ II Ligation Module (New England Biolabs) following the manufacturer’s instructions and then purified by 0.8 volumes of AMPure XP beads (Beckman Coulter).
-
bioRxiv - Biochemistry 2020Quote: ... The doubly-digested vectors were assembled with a single fragment containing the ORF containing 5’ and 3’ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2020Quote: ... reverse primer S-D-Bact-0785-b-A-18 (5’ TAC NVG GGT ATC TAA TCC 3’) and a high fidelity Taq polymerase master mix (Q5, New England Biolabs, Massachusetts, USA). Primer sequences were based on Klindworth et al.24 ...
-
bioRxiv - Microbiology 2020Quote: ... 1-3 μg RNA was used to generate sequencing libraries with NEBNext Ultra™ RNA Library Prep Kit for Illumina (#E7530L, NEB, USA) with poly(A ...
-
bioRxiv - Plant Biology 2021Quote: The purified PCR reaction was then A-tailed with 15 units Klenow Fragment (3’ – 5’ exo-) (New England BioLabs; Ipswitch, MA, USA) in 1X NEB Buffer 2 (New England BioLabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The solution was transferred to 42°C for 15 min and incubated overnight in 3 U of β-agarase I (New England Biolabs, M0392). Next ...