Labshake search
Citations for New England Biolabs :
6051 - 6100 of 6282 citations for 6 Quinolinamine 1 ethyl 1 2 3 4 tetrahydro 2 2 4 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... The pUdO#a was obtained by assembling four fragments (Table 1 and Figure S1) using the Gibson Assembly® Master Mix (New England Biolabs, E2611) according to the supplier’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... 1 µg of the duplex was in vitro transcribed using the HiScribe™ T7 Quick High Yield RNA Synthesis Kit (NEB # E2050S) following the standard IVT protocol and purified using Monarch® RNA Cleanup columns (NEB # T2030).
-
bioRxiv - Evolutionary Biology 2023Quote: ... we purified the products of the ace-1 PCR (see above) using the BS664-250 Preps EZ-10 Spin Column PCR Purification kit (New England BioLabs, Evry France). The purified PCR products were then cloned (TOPO TA Cloning Kit pCR 2.1-TOPO Vector and TOP10F’ invitrogen bacteria) ...
-
bioRxiv - Genetics 2024Quote: ... HMW DNA was also isolated from six PBMC samples (± 1 x 106 cells) using the Monarch® HMW DNA Extraction Kit for Cells & Blood (NEB, #T3050L) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Linker ligation at 3’ ends was set up per sample after washes following alkaline phosphatase treatment by preparing a T4 RNA ligase 1 (NEB, cat. #M0204S) reaction in 40μL following the manufacturers’ instructions with 100pmol of radiolabeled L32 RNA linker ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were digested in a 20 μl reaction with NEB Cutsmart buffer for 30 minutes - 1 hour with SmaI (NEB, Cat# R0141) to assess rDNA promoter methylation or with HpaII (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: 1 µg total RNA was used for NEBNext® Ultra II Directional RNA Library Prep Kit (New England Biolabs, Ipswich, MA, USA). Poly-A selection and cDNA synthesis were performed according to NEB protocol ...
-
bioRxiv - Biophysics 2023Quote: ... For each sample a separate chamber with closed nanosensors was prepared and filled with 1×CutSmart™ buffer (New England BioLabs, USA) containing 50 mM potassium ...
-
bioRxiv - Plant Biology 2023Quote: Approximately 1 ug of RNA was used as input to the NEBNext Poly(A) mRNA magnetic isolation module (New England Biolabs, catalog #E7490S), followed by NEB Ultra II RNA library prep kit for Illumina (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: ... appropriate number of amplification cycles x (98C - 10sec, 63C – 30sec, 72C – 1 min) with NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs, #M0541S) and barcoded Nextera primers (1.25 μM each ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA was synthesized from 1 μg total RNA using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, catalog #E6560S) with oligo-dT priming according to the manufacturer protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR reactions were run on a 1% agarose gel and positive bands were excised and purified using Monarch Gel extraction clean kit (NEB, Cat. #T1020L). A-tailing of the fragments was carried out by incubating the DNA with MyTaq polymerase (NEB ...
-
bioRxiv - Genomics 2024Quote: The combined pool of purified DHS fragments (∼1 μg) was end repaired and ligated to NEBNext adaptor (included in NEB cat. # E7645S) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... Transcription templates were prepared by PCR using primers complementary to the T7 promoter and terminator sequences (see Supplementary Table 1) or by digestion of the plasmid DNA with SphI (NEB, Cat# R3182S). mRNA fragments were prepared by in vitro transcription with T7 RNA polymerase using a ratio of 10:30 AU:GC NTPs ...
-
bioRxiv - Molecular Biology 2024Quote: ... SEGS-1 region N was generated by cleaving the Kpn1 site using the Q5-site directed mutagenesis protocol (New England Biolabs, Ipswich, MA) from S1-1.5a (pNSB1829 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and joining SEGS-1F and SEGS-1G using the indicated primers in Supplementary Figure 1 and the Q5 high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA). All the primers except for those for site-directed mutagenesis added NotI restriction sites at the 5’ and 3’ends of PCR products ...
-
bioRxiv - Synthetic Biology 2024Quote: The reaction was brought up to 50 uL with the addition of CutSmart (final concentration 1X) and 1 uL DpnI (NEB, Catalog #R0176S) and incubated for 1 hour at 37 °C ...
-
bioRxiv - Genomics 2021Quote: ... and washed 3 times with ice-cold 10 mM Ribonucleoside Vanadyl Complex (RVC) (New England BioLabs, cat.no. S1402S, Ipswich, Mass, USA) in buffer A (10 mM NaCl ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 10 µl was mixed with 40 µL of 1x NEBuffer 3 supplemented with 10 mM MgCl2 and 5 units of Mbo I (New England BioLabs #R0147L). This reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3’UTRs were combined to the TagRFP-T CDS using the Gibson assembly Master Mix (Cat#E2611, New England BioLabs Inc). The resulting fragment was then amplified via PCR and digested prior ligation into a vector containing only Hofstenia promoter region ...
-
bioRxiv - Cell Biology 2022Quote: ... The mixture was incubated for 3 days at 37 °C in the dark for conjugation and purified for 3 rounds using Monarch® PCR & DNA Cleanup Kit (5 μg) (Cat# T1030S, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid was linearized with SacI or XhoI (for transcription from T7 or SP6 promoter respectively) and 3’UTR fragment was transcribed in vitro using SP6 or T7 polymerases (New England Biolabs, UK) and the DIG RNA labelling Mix (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA probes were complimentary to the 3′-UTR regions immediately adjacent to the poly(A) tails and were labeled with T4 PNK (NEB, M0201S) and [γ-32P]ATP (PerkinElmer) ...
-
bioRxiv - Cell Biology 2022Quote: ... 200 pmol of an equimolar mixture of all gene-specific oligos for each gene were mixed with 250 pmol of the appropriate FLAP oligo in 1x NEBuffer 3 (New England Biolabs, B7003), then incubated in a Thermocycler (BioRad ...
-
bioRxiv - Genomics 2022Quote: ... an adenylated 5’ end and a dideoxycytosine blocked 3’end – was ligated to size-selected small RNAs using T4 Rnl2tr K227Q (NEB, M0351L) for 16 hours at 25°C ...
-
bioRxiv - Genomics 2020Quote: ... The PCR product and pGAD-C1 vector were digested with ClaI (5’-ATCGAT-3’, New England BioLabs Inc., MA, CA#R0197S) and SalI (5’-GTCGAC-3’ ...
-
bioRxiv - Physiology 2019Quote: ... 5’-TGTGCTGAGAAAACGCAGGT-3’ and sgRNA2: 5’-TGTCAACTGAAGGACCCAAG-3’) The template sequence was transcribed into RNA using a T7 RNA polymerase (New England Biolabs, E2040S) after which the DNA template was removed by treatment with RNase-Free DNaseI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-CACCAAAATGCTAAAGCCATCGATTATCTGCCTCTTTTTGGGCATTTTGGCGAAA TCATCGGCGGGCCAGTTCATGAAGGATAACACCGTGCCACTG-3’ and 5’-CTATTATCACAGTTCCTCTTTTTCTGCACTACGCAGGGATATTTCACCGCCCATCC AGGG-3’ were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing the E ...
-
bioRxiv - Cell Biology 2019Quote: ... Homologous 15bp overhangs on the 3’ end of the inverse PCR primers were ligated following the NEB T4 Ligation protocol (New England Biolabs # M0202S) to introduce the 5AA sequence ...
-
bioRxiv - Cell Biology 2019Quote: A derivative vector from modified TMPrtTA (3, 70) was created with NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs). Backbone was digested with EcoRV-HF (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... We tested various restriction digestion conditions in order to reliable separate all transgene copies (Sup. Fig. 3) and decided to perform overnight digestions with HindIII-HF or DpnII (NEB, USA) in CutSmart buffer ...
-
bioRxiv - Genomics 2021Quote: Capping with 3’ Desthiobiotin GTP (DTB-GTP) was performed in 50 µl total volume with 5 µL Vaccinia capping enzyme (NEB M02080) and 0.5 mM DTB-GTP (NEB N0761) ...
-
bioRxiv - Microbiology 2021Quote: ... the SAG1 3’UTR was amplified from pNJ-26 and cloned into the tagging plasmid to replace DHFR 3’UTR by Gibson assembly (NEB, E5520S). BAG1-mCherry GCaMP6f reporter tachyzoites were co-transfected with 10 μg of pSAG1::CAS9-U6::sgDHFR 3’UTR and 2 μg of PCR amplified P2A-mTagBFP2-HXGPRT flanked with 40 bp homology regions ...
-
bioRxiv - Cell Biology 2021Quote: ... The library was PCR amplified using universal primers that annealed to the common flanking sequence and appended homologous sequences at 5’ and 3’ ends of the PCR product to enable Gibson assembly (New England Biolabs E2611) into pZLCv2_puro_1KF ...
-
bioRxiv - Neuroscience 2020Quote: Overlapping fragments of the unstable NaV1.1 cassette-3 were amplified in polymerase chain reactions (PCR) using Q5® Hot Start High Fidelity 2x Master mix (New England Biolabs) and the primer pairs listed in Table S1 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’ homozygous arm was amplified from y,sc,v genomic DNA using Q5 High-Fidelity DNA Polymerase (New England BioLabs, NEB) with primers ...
-
bioRxiv - Microbiology 2020Quote: ... All genomic insertions were targeted to the 3’ end of the glmS gene of ICC8001 and all constructs were generated by Gibson Assembly (New England Biolabs, US).
-
bioRxiv - Neuroscience 2020Quote: ... 3 DNA fragments were generated with PCR from genomic DNA or plasmids using Q5 High-Fidelity DNA Polymerase (NEB Cat# M0491). Fragment 1 included the genomic DNA between guide 1 and the KI site plus flipped guide 2 (with PAM ...
-
bioRxiv - Molecular Biology 2021Quote: ... Pre-miRNAs were purified on denaturant polyacrylamide gel and long pri-miR-K10/12 derived transcripts (up to ∼3 kb) were salt purified using Monarch® PCR and DNA cleanup kit (New England BioLabs). After acidic phenol extraction and ethanol precipitation ...
-
bioRxiv - Developmental Biology 2022Quote: ... fluorescent protein mCherry sequence and self-cleaving P2A peptide sequence (5’HA-H2B-mCherry-P2A-3’HA) in a pUC19 vector backbone using Gibson Assembly (New England Biolabs (NEB), E5510S) ...
-
bioRxiv - Microbiology 2020Quote: ... The 3’ends of end-repaired DNA were extended with an A-overhang with 3’ to 5’ exonuclease-deficient Klenow DNA polymerase (NEB, M0212L). The resulting fragments were ligated to Nextflex 6bp adaptors (Bio Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... and BGH reverse (5’-TAG AAG GCA CAG TCG AGG -3’) primers from the pcDNA3.1+/-C-(K)-D vector using standard methods (NEB 2x Q5) which include 5-10 ng DNA per reaction ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA template for the assay was generated by annealing a primer (5′-CCCAGTCACGACGTTGTAAAACG-3′) to M13mp18 single-stranded DNA (New England Biolabs, N4040S). The assay was initiated by incubation of 1nM of DNA template with 1 mM ATP ...
-
bioRxiv - Evolutionary Biology 2022Quote: pBGC24 was used to construct pBGA by exchanging the cat gene (chloramphenicol resistance) with aac(3)-IV (apramycin resistance) from pMDIAI31 by Gibson assembly (New England Biolabs, UK). pLC10-Apra was constructed by exchanging the aph(3’)-Ia gene (Kanamycin resistance ...
-
bioRxiv - Microbiology 2019Quote: ... An RNA adaptor (5’ GACCUUGGCUGUCACUCA-3’) was ligated to the 5’-monophosphate of the RNA end by incubation with T4 RNA ligase (NewEngland BioLabs, Inc.), at 25°c for 16 h ...
-
bioRxiv - Cell Biology 2019Quote: ... The 5’ end and the 3’ UTR amplicons were cloned in the pmEGFP-Neo4 vector (Briguglio et al., 2013) by Quick Ligation (New England, Biolabs Inc.) at SacI/NheI and XhoI/ApaI sites ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resulting amplicon was assembled with a hHBB-Nluc sequence that lacked a 3’ UTR but maintained a unique barcode using a NEBuilder HiFi Assembly Kit (NEB, ES2621).
-
bioRxiv - Cell Biology 2020Quote: Three point mutations in the predicted miR-145 seed binding site in DUSP6 were introduced in pGEM-T-DUSP6 3’UTR using a Phusion® site-directed mutagenesis kit (NEB) and the mutagenic primers ...