Labshake search
Citations for New England Biolabs :
6001 - 6050 of 9425 citations for Mouse Plectin PLEC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... ligation and enrichment using the NEBNext® Ultra™II DNA Library Preparation kit (New England Biolabs Inc, Ipswich, MA). Furthermore ...
-
bioRxiv - Genomics 2020Quote: ... Illumina adaptors for paired-end sequencing were ligated using the NEB Next DNA Library Prep Master Mix for Illumina kit (New England Biolabs). After each step ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNAs were used as templates for SYBR green-based one-step reverse-transcriptase quantitative PCR (RT-qPCR) using the NEB Luna One-Step RT-qPCR kit (New England Biolabs). All primers were validated by standard curve analysis and had PCR efficiencies ranging from 90-110% ...
-
bioRxiv - Genomics 2021Quote: The subsequent fragmented gDNA was used as the starting input for the NEBNext Ultra II library prep kit for Illumina (E7645, New England Biolabs) following the manufacturer’s recommendations until the USER treatment step ...
-
bioRxiv - Genomics 2021Quote: ... All the other gDNA from the bacteria presented in Table 1 were isolated using the Monarch genomic DNA purification kit (T3010S, New England Biolabs). Xp12 phage genomic DNA was obtained from Peter Weigele and Yian-Jiun Lee at New England Biolabs.
-
bioRxiv - Genomics 2021Quote: The subsequent fragmented gDNA was used as the starting input for the NEBNext Ultra II library prep kit for Illumina (E7645, New England Biolabs) following the manufacturer’s recommendations until the USER treatment step ...
-
bioRxiv - Genomics 2021Quote: PCR amplification of the samples was done following NEBNext Ultra II library prep kit for Illumina protocol (ER7645, New England Biolabs) and the NEBNext® Multiplex Oligos for Illumina®(E7337A ...
-
bioRxiv - Microbiology 2021Quote: ... was added to in vitro transcription reactions according to the HiScribe T7 Quick High Yield RNA Synthesis Kit protocol (New England Biolabs). RNAs were included in phase separation assays at a final concentration of 16 nM (500:1 protein:RNA ratio).
-
bioRxiv - Genetics 2021Quote: ... NEB #E7490) followed by library generation using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB E7760/E7765) per manufacturer protocols ...
-
bioRxiv - Genetics 2020Quote: ... The eluted samples were treated with Proteinase K and DNA was purified using the Monarch PCR and DNA Cleanup Kit (NEB).
-
bioRxiv - Microbiology 2020Quote: ... The NEBNext Directional RNA Library Prep Kit (Purified mRNA or rRNA Depleted RNA protocol; New England BioLabs, Beverly, MA, USA) and TruSeq Index PCR Primer barcodes (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: ... Library preparation from mRNA and from miRISC-isolated RNA was performed using a NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) and Universal i5 and i7 primers following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Library preparation from human islets total RNA (200ng) was performed using a NEBNext Low Input RNA Library Prep kit (NEB). Sequencing was performed on a HiSeq4000 using 75 bp paired end reads according to Illumina specifications ...
-
bioRxiv - Microbiology 2020Quote: ... (88) by Gibson assembly (89) using the commercially available NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs, Ipswich, MA). We introduced the lasR complementation construct into BB8 by electroporation (90 ...
-
bioRxiv - Neuroscience 2021Quote: ... The polymerase chain reaction (PCR) was performed on a genomic rat DNA template using a Taq PCR Kit (New England Biolabs), and the subsequent PCR product was purified using a Qiagen PCR Purification Kit (Life Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were quantified and ∼80 ng of dsDNA was carried forward to library preparation using the NEBNext Ultra DNA Library Prep Kit for Illumina and NEBNext Multiplex Oligos for Illumina (New England Biolabs). Following twelve cycles of PCR enrichment ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA libraries with unique barcodes were generated from 100 ng enriched mRNA using the NEB Next UltraII Directional RNA Library Prep kit for Illumina (New England Biolabs). The individual cDNA libraries were assessed for quality and quantity by Qubit ...
-
bioRxiv - Microbiology 2019Quote: In vitro transcribed 3X-FLAG tagged manY transcripts – wild-type or Δenh (1 pmol) were translated in vitro using the PURExpress translation kit (NEB). Translation reactions were stopped by adding Laemmli sample buffer (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Preparation of ChIP-seq library and ChIP sequencing was prepared with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... The 3xHA epitope tag in the knock-in construct was replaced by a 3xFlag epitope tag using the Q5 site-directed mutagenesis kit (NEB). The newly generated knock in sequence was amplified in a multi-step PCR reaction adding the terminator sequence from the pEv200 plasmid and BssHI and HindIII restriction site ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was sheared to an average fragment size of 350-400 pb using the Covaris S220 and sequencing libraries were prepared on beads using the NEB Next Ultra II DNA Library Prep Kit for Illumina and NEBNext Multiplex Oligos for Illumina (New England Biolabs) following instructions from the Arima Hi-C kit.
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length 265 nt 5′ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Molecular Biology 2021Quote: RNA sequencing library was performed using the NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760L), following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... several hundred cells exhibiting highest fluorescent intensity in the corresponding channel were collected and subjected to whole genome amplification using a commercially available whole genome amplification kit (WGA, New England BioLabs) followed by PCR amplification ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR products were gel purified and transcribed in vitro using the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB). Cas9 mRNA was synthesized from the pX330 plasmid using the mMESSAGE mMACHINE® T7 Ultra (Thermofisher ...
-
bioRxiv - Developmental Biology 2021Quote: A plasmid encoding mouse ADAMTS6 with a C-terminal myc/his tag was generated previously (31) and used for site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit; E0554; New England BioLabs) to introduce Ala at Glu404 ...
-
bioRxiv - Developmental Biology 2021Quote: ... A small multiple cloning site was added before the start codon of exon 1 by site directed mutagenesis (Q5 SDM Kit, New England Biolabs) using the primers rab11a-MCS-SDM-forward 5’-tactagttccATGGGGACACGAGACGAC-3’ and rab11a-MCS-SDM-reverse 5’-agaccggtaggCTCGATCAAAACAAAAGCGC-3’ ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The Nanopore library was prepared using Oxford Nanopore Technologies ligation sequencing kit (SQK-LSK108) from 4 μg of T7 endonuclease I (New England Biolabs) treated WGA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bulk KP libraries were prepared from 500 ng of total RNA by the Genome Analysis and Technology Core at the University of Virginia using mRNA oligo dT-purified with the NEB Next Ultra RNA library preparation kit (NEB).
-
bioRxiv - Evolutionary Biology 2020Quote: ... and single bands of the expected size were excised and purified with a Monarch DNA Gel Extraction kit (New England Biolabs). Libraries were constructed using 1ng of input DNA in a Low Input ...
-
bioRxiv - Microbiology 2021Quote: ... or riboPOOLs (siTOOLs Biotech) before library preparation with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). The sequencing was performed at the Center for Cancer Research Genomics Core Facility ...
-
bioRxiv - Microbiology 2021Quote: ... Official CDC SARS-CoV-2 N1 gene primers and TaqMan probe set were used [58] with the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs):
-
bioRxiv - Developmental Biology 2021Quote: ... DNA libraries for RNAseq analysis were prepared using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, NEB) and NEBNext rRNA Depletion Kit (Human/Mouse/Rat ...
-
bioRxiv - Developmental Biology 2020Quote: ... 20ng of total RNA were used to generate barcoded RNA-seq libraries using the NEBNext Ultra RNA Library preparation kit (New England Biolabs). The size and the concentration of the libraries were checked using the TapeStation 2200 DNA 1000 chip ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fragmentation of mRNA followed by reverse transcription and second strand cDNA synthesis was done using NEBNext Ultra RNA Library Prep Kit for Illumina (E7530, NEB). Sequencing libraries were constructed using ThruPLEX DNA-seq kit (Takara R400428) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3 fragments have been inserted into pCS2+ plasmid linearized with Xho1 using the Gibson Assembly Cloning Kit (New England Biolabs): a first fragment of 4161bp of the ancBE4max to the PIM domain (amplified using the primers F-5’-CGATTCGAATTCAAGGCCTCATGAAACGGACAGCCGAC-3’ and R-5’-CGGTCTGGATCTCGGTCTTTTTCACGATATTC-3’) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and Poly-A mRNA-seq libraries from such samples were prepared using the Ultra II Directional RNA Library kit (New England BioLabs) according the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Stranded RNA-seq library construction was then performed on the rRNA-depleted RNA using the Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs), following manufacturer’s specifications for library construction and multiplexing ...
-
bioRxiv - Microbiology 2020Quote: ... Final Illumina libraries were assessed for quality using an Agilent Bioanalyzer DNA High Sensitivity Assay and qPCR quantification was performed using NEBNext Library Quant kit for Illumina (New England Biolabs). Individual libraries were pooled equimolarly ...
-
bioRxiv - Molecular Biology 2022Quote: ... which were subsequently transcribed to produce copies of the mRNAs using an in vitro transcription kit (New England Biolabs, UK) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... or SalI (pT7/SL3 or pT7/FLC background) and RNA transcribed using a HiScribe T7 High Yield RNA Synthesis kit (NEB) following the manufacturers’ protocol ...
-
bioRxiv - Microbiology 2022Quote: ... The purified cDNA was then ligated with 5’ adapter (5’/5Phos/AGATCGGAAGAGCGTCGTGTAGCTCTTCCGATCTN10/3SpC3/-3’ with 1:20 molar ratio of RNA to 5’adapter) using Quick Ligation Kit (NEB) at 37°C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... the BsaI cut site present in the newly assembled vector was converted to a BsmBI cut site using the Q5 Site-Directed Mutagenesis kit (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... Ribosomal RNA was removed from the samples using NEBNext® Ultra™ Directional RNA Library Prep Kit (NEB, Massachusetts, U.S.). Sequencing libraries were generated using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Biochemistry 2022Quote: ... a cysteine was added to the N-terminus of the coding sequence directly after the precision protease recognition site or after the six-histidine tag on the C-terminus using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2019Quote: ... 750 ng RNA were used to build the next generation sequencing libraries with the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England BioLabs), NEBNext Poly(A ...
-
bioRxiv - Molecular Biology 2019Quote: ... 50 ng of DNA in 50 ul water was used for library preparation using the Ultra II library kit (NEB) as per the manufacturer’s instructions with 6 cycles at the amplification step.
-
bioRxiv - Neuroscience 2021Quote: ... guide RNA (gRNA) sequences were inserted into pU6-BbsI-chiRNA 54 using the Q5 site-Directed Mutagenesis Kit (New England Biolabs). Each PCR used a common primer GAAGTATTGAGGAAAACATA and a primer containing the gene specific gRNA sequence followed by GTTTTAGAGCTAGAAATAGC ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA library preparation was performed according to the standard protocol of the NEBNext Ultra RNA Library Prep Kit for Illumina (New England BioLabs). The synthesized double-stranded cDNA was end-repaired using NEBNext End Prep Enzyme Mix before ligation with NEBNext Adaptor for Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was extracted as above and 300 ng of total RNA was used for library preparation using the NEBNext Ultra II Directional Library Prep Kit for Illumina with the mRNA isolation module and NEBNext Multiplex Oligos for Illumina (New England Biolabs). DNA quality was assessed by Fragment Analyzer NGS (Agilent) ...