Labshake search
Citations for New England Biolabs :
551 - 600 of 5774 citations for Recombinant Human Endothelin Converting Enzyme 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... and treated with USER enzyme (NEB, Ipswich, MA). Products were amplified by PCR with the Kapa HiFi polymerase (Kapa Biosystems ...
-
bioRxiv - Molecular Biology 2019Quote: ... The HIS-SUMO-BAHEPR-1 fusion and HIS-SUMO tag constructs were expressed in Escherichia coli BL21 DE3 cells (New England BioLabs). Both HIS-SUMO-BAHEPR-1 and HIS-SUMO cultures were initially grown in 4 liters of LB media at 37 °C at 200 RPM until cultures reached an optical density of ∼ 1.0 at 600 nm and then cultures were pelleted ...
-
bioRxiv - Microbiology 2021Quote: ... which were incubated with 1 μg/ml full-length S protein with His tag that had been pretreated with or without FXa (P8010L, NEB) for 2 hours at room temperature ...
-
bioRxiv - Genetics 2019Quote: ... The donor sequence was generated by subcloning 596 bp upstream of the hrpk-1 stop codon and 600 bp downstream of hrpk-1 stop codon into the pDD282 vector [45] using Hi Fi assembly kit (NEB). The hrpk-1 stop codon was eliminated from the donor sequence to allow in frame GFP tag addition ...
-
bioRxiv - Biophysics 2023Quote: ... The TRAK1 construct was made through assembling His-ZZ-TEV-SNAP tag and TRAK1(1-395) into a pACEBac1 vector via HIFI DNA assembly kit (NEB). All constructs were verified using whole plasmid sequencing from Plasmidsaurus.
-
bioRxiv - Microbiology 2019Quote: ... Primer sequences were as previously described.7 Samples were digested with 1 unit of BamHI-HF enzyme (NEB) prior to running the PCR ...
-
bioRxiv - Microbiology 2021Quote: ... the cap-1 structure was added to the 5’ end using the Vaccinia capping enzyme (New England Biolabs) and Vaccinia 2’-O-methyltransferase (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 million permeabilized cells (without any antibodies bound) were incubated with 4 units of Dam enzyme (NEB, M0222L) during the activation step ...
-
bioRxiv - Microbiology 2021Quote: ... The ~1 kb fragment was then digested with restriction enzymes EcoRI and HindIII (New England Biolabs, Ipswitch MA), purified using Fisher’s GeneJET Gel Extraction and DNA Clean Up Kit (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... The probes were subjected to a 1:30 dilution of uracil-specific excision reagent (USER) enzyme (NEB, N5505S) for about 24h at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μl of methylation-sensitive restriction enzyme DpnI and 2 μl CutSmart® buffer (both from NEB inc.) were added to the assembled reaction and incubated at 37 °C for 30 min ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR product was then restriction enzyme digested at 37° C for 1 hour with MseI (New England Biolabs) and then run on a 1.5% Agarose gel ...
-
bioRxiv - Genomics 2023Quote: ... LIDAR-3_RT_antisense was digested by adding 1 μL of USER II enzyme (New England Biolabs, Cat. No M5508S) and incubating at 37°C for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... PTEN and PD-1 were subcloned into linearized pLJM1-empty vector using EcoR1 and NHE1 restriction enzymes (NEB) and Takara’s two-step In-Fusion® snap assembly (#638948 ...
-
bioRxiv - Plant Biology 2019Quote: ... MBP-tagged proteins were purified using amylose resin (New England Biolabs, #E8021S) according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2020Quote: ... MBP-tagged proteins were purified by amylose affinity chromatography (New England Biolabs) following manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... and MBP-tagged proteins were purified on Amylose resin (New England Biolabs).
-
bioRxiv - Cell Biology 2023Quote: ... GST-tagged proteins were purified on glutathione-Sepharose beads (New England Biolabs), and MBP-tagged proteins were purified on Amylose resin (New England Biolabs).
-
bioRxiv - Biochemistry 2024Quote: ... Isolated MBP-tagged VPS26C was purified using Amylose beads (New England Biolabs) and eluted using 20 mM Tris pH 8.0 ...
-
bioRxiv - Genomics 2022Quote: ... and 30 nM recombinant Cas9 nuclease (NEB, M0386S) at 37°C for 2 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 or 500 units of recombinant CK2 (NEB), 5µM or 15µM silmitaserib (CK2 inhibitor ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.1 mg/ml recombinant albumin (New England Biolabs), 0.1 mg/ml RNase A (QIAGEN) ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.1 mg/ml recombinant albumin (New England Biolabs), and 0.1 mg/ml RNase A (QIAGEN)] ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2014) by incubating 0.25 μl of plasmid with 1 μl of recombinant Cre recombinase (New England Biolabs M0298S) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: NSD1/2 WT and different cancer mutants (3.4 μM) were mixed with recombinant H3.1 protein (1 μg) (purchased from NEB) or recombinant H3.1 mononucleosomes in methylation buffer (50 mM Tris/HCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-GTAGTACCATGCCGAAAGCAC-3’, Reverse: 5’-GGAACCACCTATCTGTTATCC-3’, Restriction Enzyme: TseI, NEB R0591). Knockout lines were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-TGGCGCTAGTATTTGAAGCA-3’, Reverse: 5’-ACTTGGGATCCAATTCTGTCTACT-3’, Restriction Enzyme: EcoRI, NEB R3101). Specific mutations were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Bioengineering 2023Quote: ... The amplification of repetitive units was generated by BioBrick restriction enzyme assembly using NheI and SpeI enzyme sets (New England BioLabs, USA). Subsequently ...
-
bioRxiv - Bioengineering 2023Quote: ... DECIPHER comes with a set of 214 restriction enzymes for sale at New England Biolabs (referred to as NEB restriction enzymes). To obtain the null distribution of CoV restriction maps ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid pJAM2678 containing the bgaH gene encoding the β-galactosidase enzyme from Haloferax alicantei (52) was linearized using XbaI and NdeI compatible restriction enzymes (NEB) and purified from TAE agarose gels as explained previously (53) ...
-
bioRxiv - Microbiology 2024Quote: ... The purified SOE PCR product was double-restriction enzyme-digested and ligated into a pk18mobsacB vector previously double-digested with the corresponding enzymes and dephosphorylated with rSAP (NEB, UK). The constructs were transformed into E ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The two fragments were assembled using HI-FI assembly (NEB E5520S). To construct the Prcan-1-R1∷mCherry and Prcan-1-R2∷mCherry plasmids ...
-
bioRxiv - Immunology 2021Quote: ... The fragments were assembled using Hi-Fi DNA Assembly Mix (NEB). For the DonorgRNA vector ...
-
bioRxiv - Genomics 2021Quote: ... and 25 µl 2x NEBNext Hi-Fi PCR mix (NEB, USA) per reaction ...
-
bioRxiv - Biochemistry 2021Quote: ... Nb35–His (10 μg/mL) and apyrase (25 mU/mL, NEB); the suspension was incubated for 1 h at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Nb35–His (10 µg/ml) and apyrase (25 mU/ml, NEB). The suspension was incubated for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: His-MBP-Fbp17SH3 was precipitated by amylose beads (NEB; cat#E8021L). After purification ...
-
bioRxiv - Plant Biology 2022Quote: ... and MBP-HIS-GFP proteins were purified with amylose resin (NEB) and SUMO-HIS-BIN2 protein was purified with Ni-NTA Agarose (Qiagen).
-
bioRxiv - Genetics 2023Quote: ... To facilitate homology directed assembly (Gibson or NEB Hi Fi assembly), 30bp homology with the preferred SEED cassettes were included at each site of the BsaI sites ...
-
bioRxiv - Synthetic Biology 2023Quote: ... For his purpose pEKEx2 was first linearized using SacI (NEB, USA). The gene for mCherry was amplified by PCR using the primer pairs low_mCherry_fw and low_mCherry_rev (Table S1 ...
-
bioRxiv - Cell Biology 2023Quote: ... For all Gibson Assemblies the NEB Hi-Fi Assembly Mastermix (NEB) was used ...
-
bioRxiv - Genetics 2019Quote: ... resulting PCR products were digested with a restriction enzyme or a combination of multiple restriction enzyme assays able to discriminate among Saccharomyces species (New England Biolabs, Ipswich, MA). An extended PCR-RFLP pattern ...
-
bioRxiv - Genomics 2022Quote: ... Chromatin within the nuclei was overnight digested at 37ºC and 950rpm after adding 7.5μl of HindIII restriction enzyme at 100U/μl or 37.5μl of MboI restriction enzyme at 25U/μl (New England Biolabs cat. #R0104T or #R0147M). The following day ...
-
bioRxiv - Systems Biology 2023Quote: ... The two intermediate libraries were cloned together using high-efficiency cloning and standard restriction enzyme-mediated cloning with enzymes AvrII (New England Biolabs, Ipswitch, MA) and HindIII-HF (New England Biolabs ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µg of genomic DNA was digested with one of few combinations of restriction enzymes (Table S5, all enzymes from NEB, Ipswich, MA). Digested genomic DNA was ligated using T4 ligase (NEB ...
-
bioRxiv - Genetics 2021Quote: ... 1μl XhoI digestion mix consisting of 5U XhoI restriction enzyme and 1 x NEB buffer 2.1 (New England Biolabs), and 10 ng genomic DNA for iciHHV-6B samples or 200 ng DNA for non-iciHHV-6B samples ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 (1) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). In addition ...
-
bioRxiv - Molecular Biology 2020Quote: ... 8 μl 5x PNK pH 6.5 buffer [350 mM Tris-HCl pH 6.5, 50 mM MgCl2, 5 mM DTT], 1 μl PNK enzyme [NEB] ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... Genomic DNA (2 μg) was then treated with buffer alone or with 1 unit RNase H enzyme (NEB, MO297S) for 2 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... the beads were incubated with 1 µl CK2 enzyme and 1X CK2 reaction buffer (NEB Inc; catalog no. P6010S) supplemented with 200 µM ATP and 30 mM MgCl2 and rotated for 1 h at 30ºC ...