Labshake search
Citations for New England Biolabs :
551 - 600 of 2065 citations for 7 7 Dimethyl 6 8 dioxaspiro 3.5 nonan 2 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... Genomic DNA was harvested by discarding culture media and adding lysis buffer consisting of 20 mM Tris pH 8 and 0.1% Triton X-100 (MilliporeSigma T9284) with 60 ng/mL of Proteinase K (New England Biolabs P8107S) added immediately prior to use ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 ng of DNA was digested with 6 to 12 U of the restriction enzyme PvuII (NEB) overnight at 37°C.
-
bioRxiv - Genomics 2020Quote: ... DNA libraries were amplified by PCR for 6-10 cycles with Phusion HF DNA Polymearse (NEB, M0530) using Illumina TruSeq indexing primers for multiplexing ...
-
bioRxiv - Cell Biology 2020Quote: ... Images were collected every 10 mins for up to 6 days and the timing of events (NEB, the start of cytokinetic furrow ingression and the appearance of 2 distinct cells ...
-
bioRxiv - Microbiology 2019Quote: ... the product was cloned into the pET1-5b N-terminal 6×His expression plasmid (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... Desialylation of Calu-3 cells was achieved by incubating cells grown in a 96 well plate or 24-well plate or 6 well plate with 100 U/mL α2-3,6,8,9 neuraminidase A (P0722L, NEB) in 10% FCS media for 3 h at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... reactions were performed with 6 μl of PURExpress ΔRF123 in vitro protein synthesis system (New England Biolabs) in the presence of 1x RF3 ...
-
bioRxiv - Systems Biology 2023Quote: ... N6-(6-Azido)hexyl-3’-dATP were added to ssDNA oligos (Biolegio) using terminal transferase (TdT, NEB) at 25:1 molar ratio for 2h at 37°C ...
-
bioRxiv - Biophysics 2023Quote: ... and the DNA of the SL5-6 domains was then digested using BsaI (New England Biolabs #R0535) followed by Mung Bean Nuclease (New England Biolabs #M0250) ...
-
bioRxiv - Cell Biology 2021Quote: ... RHA PCR products were ligated into pAAV p21 vector by Gibson assembly at a ratio vector:inserts of 1:2:2 using T4 DNA ligase (NEB). All constructs were checked by sequencing before transfection into cells ...
-
bioRxiv - Biochemistry 2021Quote: ... sDrl-2 for crystallization was also partially deglycosylated with PNGase F (New England BioLabs: 2,000 unit/mg sDrl-2) for 3 h at room temperature before sizing.
-
bioRxiv - Systems Biology 2019Quote: ... the samples were added to 2 μL of second-strand synthesis mix (2.5× NEB buffer 2 [New England Biolabs] ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μl of this lysate was directly used for PCR reactions with 2× Taq start master mix (M0496L, NEB), and the two NASP clone screening primers (see primer table) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... These were phosphorylated (2 μL 100 μM oligo stock, 2 μL 10X T4 DNA ligase buffer (New England Biolabs), 1 μL T4 PNK (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2023Quote: ... along with 2.5 ng/μl pCFJ90(Pmyo-2::mCherry) and 77.5 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate two independent strains expressing Ex[Pcol-10::mCherry::his-58::SL2::drl-1 cDNA] (DLS515 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 nM dT adaptor primer and 200 nM Vλ1-GSP4-2-Hind III and 2 U Taq polymerase (NEB), in a final volume of 50 µl ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Evolutionary Biology 2021Quote: Reverse transcription was performed by adding the following to the above reaction: 8 uL of 5x first strand buffer (NEB E7330L), 2 uL of 10mM dNTPs (each) ...
-
bioRxiv - Molecular Biology 2021Quote: ... was resuspended in 10x NEB CutSmart Buffer (8:1) and dephosphorylated by incubation with Quick calf intestinal phosphatase (CIP) (NEB, # M0525S) at 37 °C for 20 min ...
-
bioRxiv - Biochemistry 2020Quote: ... and 8 pmol of purified DNA was then used for in vitro transcription with T7 RNA polymerase (New England Biolabs Inc.). The resulting RNA was purified with Agencourt RNAClean XP beads supplemented with an additional 12% of PEG-8000 (3 volumes of 40% PEG-8000 was added to 7 volumes Agencourt RNAClean XP beads ...
-
bioRxiv - Synthetic Biology 2019Quote: Fly genomic DNA was isolated in a pool by grinding in 25 µl of “Squish Buffer” (10 mM Tris, 1 mM EDTA, 25 mM NaCl, 8 U/ml ProK (NEB P8107S)) per adult ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Biochemistry 2021Quote: ... The RNAs were recovered from the gel slices by digesting the protein with proteinase K (8 U; P8107S, NEB, Ipswich, MA) leaving a polypeptide remaining at the crosslinked nucleotide ...
-
bioRxiv - Microbiology 2020Quote: ... After adding 10% 1M sodium dodecyl sulphate (SDS) and 10 μL of 8 U/mL proteinase K (NEB, #P8107S, Ipswich, MA), the suspension was then incubated at 56°C for 4 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 5 min and then samples were incubated with ligation buffer (8 μl of 5x ligation stock (New England Biolabs, USA), 1 μl ligase and 31 μl of ultrapure water on each coverslip ...
-
bioRxiv - Microbiology 2020Quote: ... The flies were homogenised in 100 μl of TE-buffer pH 8 containing 1% Triton X-100 and 1% Proteinase K (NEB, P8107S). Homogenates were incubated for 3 h at 55°C followed by a 10 min incubation step at 95°C ...
-
bioRxiv - Microbiology 2021Quote: A549 cells were infected with PR8 at a MOI of 5 and lysates were collected every two hours post infection (hpi) until 8 h RNA extraction was performed with Monarch total RNA Miniprep kit (New England Biolabs GmbH) according to manufacturers’ instructions ...
-
bioRxiv - Physiology 2022Quote: ... RNA-Seq libraries were prepared using the NEBNext Ultra Directional RNA Library Kit with 12 cycles of PCR and custom 8 bp indexes (New England Biolabs, UK). Libraries were multiplexed and sequenced on the Illumina HiSeq4000 as 75-nucleotide paired-end reads ...
-
bioRxiv - Microbiology 2021Quote: ... Then the product was incubated with 8 pmol of adapter and 3000 units T4 DNA ligase (MGI, 1000004279) in 80 μL of 1X PNK buffer (NEB, B0201S) with extra 1 mM ATP and 7.5% PEG-8000 at room temperature for 1 hour ...
-
bioRxiv - Genomics 2023Quote: ... DNA fragments were further size-selected by agarose gel elution and PCR amplified for 6 to 8 cycles using Illumina P1 and Index primer pair and Phusion® High-Fidelity PCR Master Mix (New England Biolabs). The final library was purified using Agencourt AMPure XP beads and quality assessed by Agilent Bioanalyzer 2100 (DNA 7500 kit ...
-
bioRxiv - Biophysics 2023Quote: ... on whose product we generate sticky ends and remove remaining pUC19 templates by a triple digest in 1X Cutsmart buffer with 8 μl SacI-HF (NEB, R3156S), 8 μl XhoI (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... Eluted fragments were amplified by PCR with an appropriate number of PCR-cycles (5-8) using Custom NExtera PCR primers50 and the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs, M0541S). Amplified DNA was purified using Qiagen MinElute Kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.8 μL of this was then used to template an 8 μL PCR using LongAmp® Hot Start Taq 2X Master Mix (M0533, NEB) with each amplification containing a unique combination of forward and reverse sequencing-barcoded primers that were cherry-picked into PCR reactions using Echo 525 with a 384PP plate as was done in the construction ...
-
bioRxiv - Biochemistry 2024Quote: ... in vitro transcription templates were prepared via 8 cycles of PCR using 2x Q5 Master Mix (New England Biolabs, Cat. M0492S) with a T7 promoter containing forward primer as previously described ...
-
bioRxiv - Genetics 2023Quote: ... oligonucleotide pools were amplified by 8 to 10 cycles of PCR using NEBNext Ultra II Q5 Master Mix (New England Biolabs, M0544X), digested with BstXI and BlpI ...
-
bioRxiv - Cancer Biology 2023Quote: ... The end-repaired DNA was ligated with 5 μl Adapter Mix (ONT, SQK-LSK110) using 8 μl NEBNext Quick T4 DNA ligase (NEB, E6056) at 21°C for up to 1h ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6×50 µl PCR reactions were set up using NEBNext Ultra II Q5 master mix (New England Biolabs) with 5 nM oligos as template ...
-
bioRxiv - Genetics 2022Quote: ... we PCR amplified NatMX from Addgene plasmid #35121 with the primers listed in Supplementary Table 6 using Phusion Hot Start Flex DNA polymerase (NEB). The NatMX cassette was transformed into the BY strain using the methods described above and transformants were plated onto YPD medium containing clonNAT ...
-
bioRxiv - Molecular Biology 2022Quote: ... The final cDNA libraries were amplified (cycle number of 6) using NEBNext Multiplex Oligos for Illumina (NEB, E7335) and purified using SPRIselect size selection beads (Beckman Coulter ...
-
bioRxiv - Biochemistry 2023Quote: ... and transformed 1 µL of the reaction mixture into 6 µL of BL21 competent cells (New England Biolabs). After heat shock and recovery in SOC media ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.6 mM of A, C, and T, NEB-N0446S; 0.1 µM Clean.G; 800 U/ml Bst Polymerase, NEB-M0374L ...
-
bioRxiv - Microbiology 2021Quote: ... was utilized using SARS-CoV-2 specific primers[43] or SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit (New England Biolabs), which became available in assays after September 15 ...
-
bioRxiv - Biophysics 2020Quote: For the insertion of an ATTO647N-labeled oligonucleotide complementary to the position 14711 bp from the biotinylated end of the λ DNA we employed the previously described strategy14 and followed the more recently described procedure.15 2 μg of λ DNA was incubated for 2 hours with the nicking enzyme Nt.BstNBI (20 units, NEB) at 50 °C in the nickase buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR product (2 μg) and pEYFP-C1 vector DNA (2 μg) were digested with BamHI-HF and HindIII-HF (New England Biolabs) according to the manufacturer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The annealing was carried out in 96-well PCR plates by mixing 2 μL of each oligonucleotide at 100 μM with 2 μL of 10x T4 DNA Ligase Reaction Buffer (NEB) and 14 μL of water ...
-
bioRxiv - Systems Biology 2021Quote: ... PCR reactions with plasmid and genomic DNA templates were performed using the Phusion High-Fidelity 2× Master Mix or Q5 High-Fidelity 2× Master Mix (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... was amplified and barcoded in parallel using the same PCR program in 50 μL PCR reaction (2 μL gap-repaired DNA, 25 μL 2× NEBNext High-Fidelity PCR Master Mix (NEB), 1.5 μL 10 μM i5 universal PCR primer ...
-
bioRxiv - Microbiology 2022Quote: ... human NINL isoform 2 (NCBI accession NM_001318226.2) and the NINL isoform 2 mutant (Q231R) were mutagenized using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). The plasmids encoding 3C proteases (coxsackievirus B3 (CVB3 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we first mixed 10.5 uL of purified RNA with 2 uL of 2 uM RT primer (AGGGACATCGTAGAGAGTCGTACTTANNNNNNNNNNAGATGAACTTCAGGGTCAGC, where Ns comprise the UMI) and 2uL of 10mM dNTP mixture (NEB), incubated the mixture at 65C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...