Labshake search
Citations for New England Biolabs :
501 - 550 of 2065 citations for 7 7 Dimethyl 6 8 dioxaspiro 3.5 nonan 2 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... in NEBuffer 2 (New England Biolabs #B6002) at 37°C for 30 minutes followed by column purification ...
-
bioRxiv - Genomics 2023Quote: ... 2 μL 10×ThermoPol Reaction Buffer (NEB), 0.5 μL 10 mM dNTP mix ...
-
bioRxiv - Cell Biology 2023Quote: Recombinant human Casein Kinase 2 (NEB, P6010S) and Protein Kinase A (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2 mM VRC (New England Biolabs).
-
bioRxiv - Genetics 2024Quote: ... 2 mM Vanadyl Ribonucleoside complex (NEB S142), 0.5% BSA (Ambion ...
-
bioRxiv - Genomics 2024Quote: ... 2 μl of Antarctic Phosphatase Enzyme (NEB), and 2 μl of water ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 μl T4 PNK (NEB, #M0201L) to the dephosphorylated nuclei sample and incubate at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2024Quote: ... + 2 mM vanadyl-ribonucleoside complex (NEB S1402) + 0.02% [w/v] BSA ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples with RNA Integrity Number > 8 were used for library preparation following the standard protocol for the NEBnext Ultra ii Stranded mRNA (New England Biolabs). Library construction and sequences was carried out at the Biomedical Research Centre Sequencing Facility (University of British Columbia ...
-
bioRxiv - Molecular Biology 2020Quote: ... PEARL extracts from cultured cells were treated with either DNase I (1 unit per every 8 μL of PEARL extract, New England BioLabs) or with RNase A (0.1 mg per every 8 μL of PEARL extract ...
-
bioRxiv - Cell Biology 2022Quote: ... In-house adapters containing 8-nucleotide unique molecular identifier (UMI) sequences were ligated onto the DNA fragments with T4 DNA ligase (NEB). Excess adapters were removed by AMPure XP beads (Agencourt ...
-
bioRxiv - Genomics 2019Quote: The circularized DNA was split into 8 50 ul rolling circle amplification (RCA) reactions (5 ul 10x Phi29 buffer (NEB), 2.5 ul 10 mM dNTPs (NEB) ...
-
bioRxiv - Genomics 2019Quote: ... We quantified DNA using a Qubit dsDNA BR assay and performed a debranching treatment on 8-10 µg of DNA in 100 µL reactions containing 50 Units of endonuclease T7E1 (New England Biolabs) in 1X NEB buffer 2 ...
-
bioRxiv - Genetics 2019Quote: The mutations comprising the pol30-8 allele (R61A, D63A) were introduced into pEAA578 (POL30∷KANMX) by Q5 site-directed mutagenesis (New England Biolabs) to create the single step integrating vector pEAA633 (pol30-8∷KANMX) ...
-
bioRxiv - Microbiology 2021Quote: ... and Bakt_805R (GACTACGVGGGTATCTAATCC)38 PCR primer pair with an individual 8 bp barcode adapter (based on the NEB Multiplex Oligos for Illumina, New England Biolabs) attached to the forward primer and the reverse primer ...
-
bioRxiv - Microbiology 2021Quote: ... the codon optimized RBD was PCR amplified and cloned into the bicistronic pDZ rescue plasmid system for A/Puerto Rico/8/1934 using the NEBuider HiFi DNA assembly kit (NEB). Specifically ...
-
bioRxiv - Molecular Biology 2020Quote: ... The converted RNA was fragmented into 150 - 200 nt fragments by incubation at 94 °C for 8 minutes in fragmentation buffer (NEB). The fragmented RNA was then used for library construction using NEBNext Ultra II Directional RNA Library Prep Kit ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4.8 mM MgCl2 and 1x reaction buffer for T7 RNAP and 62.5 units of T7 RNAP (New England BioLabs, NEB). The mixture was incubated for 2 h at 37°C.
-
bioRxiv - Molecular Biology 2020Quote: ... 4.8 mM MgCl2 and 1x reaction buffer for T7 RNAP and 62.5 units of T7 RNAP (New England BioLabs, NEB). The mixture was incubated for 2 h at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then ligated to pre-annealed double-stranded adaptors that contain single dT overhangs and a unique molecular identifier (UMI) consisting of a randomized 8-base sequence containing a 3-base specific barcode by T4 DNA ligase (NEB) overnight at 15 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 µL of the Klenow reactions were retrieved and added to 8 µL of 2x RNA Loading Dye (New England Biolabs). The mixtures were then analyzed by electrophoresis through a urea-15% polyacrylamide gel (Novex TBE-Urea gel 15% ...
-
bioRxiv - Genomics 2022Quote: ... Another half of the genomic DNA (less than 8 ng/μL) was treated with 0.2 unit/μL MseI (NEB, R0525S) for 1 hour at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5ul of PCR1 product as template was amplified using unique i5 and i7 index primer combinations with 8 cycles and Q5 High-Fidelity DNA Polymerase (NEB) for each individual sample to allow pooling of sequencing libraries ...
-
bioRxiv - Molecular Biology 2021Quote: ... 8 μg of digested nucleic acids were treated or not with 10 μl of RNase H (New England BioLabs, M029L) overnight at 37 °C in 1x RNAse H buffer and 1/10 of the samples were used as input ...
-
bioRxiv - Molecular Biology 2020Quote: ... Approximately 8 ug of <200nt RNA per sample was mixed to an equal volume of 2x loading dye (NEB #B0363A) and incubated at 70°C for 5min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Chromatin was then digested by adding 12 μl of 10x NEBuffer3.1 and 8 μl of 5 U/μl DpnII (NEB, R0543) followed by a 2h incubation at 37ºC in a ThermoMixer with shaking (900 rpm ...
-
bioRxiv - Biophysics 2019Quote: ... 10 μl of 100 μM DNA oligos containing an amino group modification at their 5’ends were mixed with 8 μl of 20 mM BG-GLA-NHS (NEB) in 40 μl of 50 mM HEPES buffer containing 50% anhydrous DMSO ...
-
bioRxiv - Biophysics 2019Quote: ... final products were separated from non-ligated fragments by electrophoresis using a 0.8-1.5% (m/V) agarose gel and extracted from the gel with the Monarch® DNA Gel Extraction Kit (NEB).
-
bioRxiv - Physiology 2020Quote: ... RNA with RIN>8 was used to prepare transcriptomic libraries using the NEBNext Ultra RNA library prep kit (New England Biolabs). High throughput RNA-Sequencing was performed at the NIDDK Genomic Core Facility (NIH ...
-
bioRxiv - Biophysics 2019Quote: ... gels were gently removed from the chamber and digested overnight at 37 °C in 8 units mL−1 Proteinase K (NEB) diluted in digestion buffer (1× TAE buffer ...
-
bioRxiv - Physiology 2019Quote: ... Qualifying samples (samples with RNA integrity numbers > 8) were then prepared following the standard protocol for the NEBnext Ultra ii Stranded mRNA (New England Biolabs). Sequencing was performed on the Illumina NextSeq 500 with Paired End 42bp × 42bp reads ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 mM CaCl2 was added and the His8 tag was cleaved through the addition of 8-16 U/mL enterokinase (New England Biolabs) for 2 days at 37°C ...
-
bioRxiv - Genomics 2021Quote: The supernatant was magnetically removed and the beads were resuspended in 20 µl of L3 DNA linker ligation mixture (8 µl water, 5 µl 4X ligation buffer, 1 µl RNA ligase [New England Biolabs] ...
-
bioRxiv - Biochemistry 2021Quote: ... Purified DNA was resuspended in 10 mM Tris pH 8 and prepared for sequencing using the NEBNext Ultra II DNA library kit for Illumina (New England Biolabs). Paired-end sequencing with 75 cycles and a 6-cycle index read was performed on the Illumina NextSeq500 system.
-
bioRxiv - Cancer Biology 2020Quote: ... 30 ng total RNA (RQI≥8) was used for library preparation following the NEBNext Ultra RNA Library Prep Kit for Illumina protocol (New England BioLabs) with the Poly(A ...
-
bioRxiv - Genomics 2020Quote: ... Zyagen samples were amplified with PBC096 barcoding for 8-10 cycles with both LongAmp (female, 62°C annealing; NEB, US) and PrimeSTAR GXL (male and female ...
-
bioRxiv - Genomics 2022Quote: Samples were digested by incubation in reverse-crosslinking buffer (50 mM Tris pH 8, 50 mM NaCl, 0.2% SDS) with 1:50 proteinase K (NEB P8107S) for 8-16 hours at 55°C ...
-
bioRxiv - Genomics 2022Quote: ... CRISPEY-BAR barcodes integrated in the genome were amplified with a first step PCR in 8 tubes of 50 uL reactions using Q5 hot-start DNA polymerase (New England Biolabs) following manufacturer recommendations ...
-
bioRxiv - Immunology 2022Quote: ... Iso-Seq libraries were generated using 500 ng high-quality (RIN > 8) RNA as input into oligo-dT primed cDNA synthesis (NEB). Barcoded primers were incorporated into the cDNA during second strand synthesis ...
-
bioRxiv - Cell Biology 2023Quote: ... Coding sequences of ric-8 and nphp-2s were amplified from a mixed-stage N2 cDNA library using Phusion high-fidelity DNA polymerase (NEB) with gene-specific primers and verified by Sanger sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... was also reverse-transcribed and Illumina sequencing library prep was followed by 8–10 cycles of polymerase chain reaction (PCR) using High Fidelity Phusion (New England Biolabs). All the libraries were barcoded in the PCR step ...
-
bioRxiv - Cancer Biology 2023Quote: ... Amplification with barcoded primers was performed with a few numbers of PCR cycles (5 to 8) and a high-fidelity polymerase (Q5, NEB). Amplified libraries were size-selected on a non-denaturing 8% acrylamide gel and purified ...
-
bioRxiv - Genomics 2023Quote: ... Samples were diluted in 8 ml of T4 DNA ligase buffer 1X and incubated 8 hours at 16°C with 8000 Units of T4 DNA ligase (NEB). Crosslinks were reversed overnight at 60°C in the presence of proteinase K (0.125 mg / ml final ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve cDNAs were then serially diluted ten-fold from 10-1 to 10-8 and run through the SYBR Green assay (New England Biolabs) together with sample cDNAs ...
-
bioRxiv - Genomics 2023Quote: ... beads were incubated with 10 µL of USER mix (1 µL of 10X USER buffer and 1 µL of USER enzyme in 8 µL of nuclease-free water, NEB) and incubated at 37°C for 15 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... Each library was dissolved in 100µL Tris 10mM pH 8 and amplified by PCR with specific primers (Fw: GTGAACCGTCAGATCGCCTCGGCACTCCAGTCCT, Rv: AGAGGGTTAGGGATAGGCTTACCTCAGGCTAGTGCGGACCGAGTCG) using NEBNext Ultra II Q5 HotStart (NEB). PCR cycling parameters were set as follows ...
-
bioRxiv - Genomics 2024Quote: ... dATP (3x 1.5 µL of 10 mM solutions) and 8 µL of 5 U/µl Klenow fragment of DNA polymerase I (New England Biolabs) and a 30-minute incubation at 37°C with rotation ...
-
bioRxiv - Genomics 2024Quote: ... Genomic DNA was harvested by discarding culture media and adding lysis buffer consisting of 20 mM Tris pH 8 and 0.1% Triton X-100 (MilliporeSigma T9284) with 60 ng/mL of Proteinase K (New England Biolabs P8107S) added immediately prior to use ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... Recombinant Muc1 or lubricin mixed with one of the following enzymes: 8 unit/mL of proteinase K (P8107S, New England Biolabs), 500 μg/mL of pronase (10165921001 ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were diluted in 8 ml of T4 DNA ligase buffer 1X and incubated 8 hours at 16°C with 8000 Units of T4 DNA ligase (NEB). Crosslinks were reversed overnight at 60°C in the presence of proteinase K (0.125 mg / ml final ...