Labshake search
Citations for New England Biolabs :
401 - 450 of 2865 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... NEB 5-alpha competent E.coli (NEB) were transformed by ligated productions using manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... 5 units DNA Pol I (NEB) with water in a total volume of 2x 20 μL ...
-
bioRxiv - Genomics 2024Quote: 5-alpha competent cells (NEB C2987H)
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL 5′-deadenylase (NEB, M0331S) was added into each ligation mixture by incubation at 30 °C for 1hour followed by adding 1 µL RecJf (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... coli NEB-5-alpha (NEB C2987) was used for plasmid cloning ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl 10x rCutSmart buffer (NEB) in a total volume of 50 μl and incubated for 15 min at 65 °C ...
-
bioRxiv - Biophysics 2024Quote: ... NEB 5-ɑ (New England Biolabs) and BL21 (DE3 ...
-
bioRxiv - Cell Biology 2024Quote: ... or NEB 5-alpha HE (NEB) E ...
-
bioRxiv - Genetics 2024Quote: ... 5 μl proteinase K (NEB, P8107) was added and the sample was mixed by pipetting ...
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’-GGCATGTGATTGGTGGGTC) was 5’ labelled with gamma 32P ATP by T4 Polynucleotide Kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5% CO2 -balanced complete cell culture medium with 5 μM SNAP-Surface Alexa Fluor 647 (NEB, S9136S), for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 120 μM m7G(5’)ppp(5’)G RNA Cap Structure Analog (M7; New England BioLabs #S1404S) was used ...
-
bioRxiv - Genomics 2024Quote: ... the 5’-end of nascent RNAs was decapped on-beads in RNA 5’ Pyrophosphorylase mix (NEB, M0356S) at 37 °C for 45 min ...
-
bioRxiv - Synthetic Biology 2024Quote: G(5’)ppp(5’)A RNA Cap Structure Analog (New England Biolabs Japan Inc., Tokyo, Japan, #S1406)
-
bioRxiv - Microbiology 2024Quote: ... the RNA was ligated to the 5′-universal RNA adapter (5′GAUAUGCGCGAAUUCCUGUAGAACGAACACUAGAAGAAA3′) using T4 RNA ligase (NEB). After extraction with 25:24:1 phenol/chloroform/isoamyl alcohol and ethanol precipitation ...
-
bioRxiv - Molecular Biology 2021Quote: ... the samples were mixed with 6× SDS-free Purple Loading Dye (New England Biolabs) supplemented with SYBR Gold and the cleavage products were resolved by native 1.2% agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2020Quote: ... 6 units of T4 DNA polymerase and 400 units of T4 DNA ligase (NEB) were then added and the reaction was incubated at 12°C for 1 hour to allow second strand synthesis ...
-
bioRxiv - Genomics 2021Quote: ... The decapped RNA was Recapped with 6 μL Vaccinia Capping Enzyme (VCE) (NEB, #M2080) in 1X VCE reaction buffer (50 mM Tris HCl ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 6 μl primers (10 μM) and 50 μl Q5 high fidelity master mix (NEB). The thermocycling parameters were ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 6-12 µg of genomic DNA was dephosphorylated with rSAP (NEB), followed by AMPure XP beads purification ...
-
bioRxiv - Molecular Biology 2022Quote: ... the samples were mixed with 6× SDS-free Purple Loading Dye (New England Biolabs) supplemented with SYBR Gold ...
-
bioRxiv - Microbiology 2024Quote: ... and 6 μg of pure enzyme (RlmJ/RlmF) or BSA (NEB, Ipswich, MA, USA) as a control [27] ...
-
bioRxiv - Biochemistry 2024Quote: ... The samples were then treated with 6 U of proteinase K (New England Biolabs) at 37 °C for 30 minutes ...
-
bioRxiv - Plant Biology 2020Quote: ... Library preparation began with digestion of 100 ng cleaned genomic DNA at 37°C for 4 h in 15 μL containing 4 U FspEI (NEB), 1X CutSmart Buffer (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was fragmented via ultrasound (4 pulses a 30 sec, 4 °C) and subsequently treated with T4 Polynucleotide Kinase (NEB). Half of the samples were then treated with terminator exonuclease (TEX ...
-
bioRxiv - Microbiology 2024Quote: ... the total RNA samples were fragmented using ultrasound (4 pulses of 30 sec at 4°C) followed by a treatment with T4 Polynucleotide Kinase (New England Biolabs). The RNA samples were then split into two halves and one half was subjected to Terminator Exonuclease treatment (+TEX) ...
-
bioRxiv - Biophysics 2023Quote: ... After 4 hours of incubation (required for transcription) RNA was directly treated with 4 units of DNase I (NEB, M0303S) to remove linear or circular DNA used as a template for transcription (see details in Supplementary Methods) ...
-
bioRxiv - Molecular Biology 2023Quote: ... pooled total RNA was fragmented with ultrasound (4 pulses of each 30 sec at 4°C) and then treated with T4 Polynucleotide kinase (NEB). The RNA of each sample was then divided in half ...
-
bioRxiv - Microbiology 2020Quote: ... 30 μL of 10x RE buffer 4 (NEB), 2 μL of exonuclease T7 (10,000 units/mL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 U of alkaline phosphatase from Biolabs (# M0290) and 5 mU of phosphodiesterase I from Sigma (# P3243-1VL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL MgSO4 (4 mM; Biolabs, Ipswich, MA), 1.4 μL dNTPs (1.4 mM ...
-
bioRxiv - Genetics 2020Quote: ... 4 µL of T4 DNA ligase (NEB #M0202M), and water to 800 µL ...
-
bioRxiv - Genomics 2020Quote: ... [4 µl 5x NEB FirstStrand buffer (NEB; E7421AA), 0.25 µl SUPERase-In ...
-
bioRxiv - Neuroscience 2021Quote: ... and the 4 base restriction enzyme Mse1 (NEB) under standard double digest conditions ...
-
bioRxiv - Neuroscience 2020Quote: ... 4 μl of Calf intestinal alkaline phosphatase (NEB) was added to dephosphorylate the RNA for 15 min at 37 °C ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 4 μl 50% PEG-800 (New England Biolabs), 4 μl 10× T4 RNA ligase buffer (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... and 4 total U of Proteinase K (NEB) at room temp for 10 min ...
-
bioRxiv - Plant Biology 2020Quote: ... and 4 units of Murine RNase Inhibitor (NEB)) ...
-
bioRxiv - Genetics 2021Quote: ... 4 units Terminal Transferase (New England Biolabs™) and were carried out at 37°C for 30 minutes followed by heat inactivation at 75°C for 10 minutes ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of Phusion HF Buffer (NEB #B0518S), 2 µL of 2 mM dNTPs (Takara #4025) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of Phusion HF Buffer (NEB #B0518S), and 0.4 µL of 10 mM dNTPs (Takara #4030) ...
-
bioRxiv - Molecular Biology 2023Quote: Proteinase solution: 4 μL proteinase K (NEB, P8107S) was added into 1 mL 0.1 M Tris-HCl 0.05 M EDTA (pH 8.0 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of Phusion HF Buffer (NEB #B0518S), 2 µL of 2 mM dNTPs (Takara #4025) ...
-
bioRxiv - Biochemistry 2023Quote: ... and 4 μL T4 PNK (New England BioLabs) in a 100 μL reaction for 2 hours at 37°C and purified using Micro-Bio P-30 spin columns (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μL Proteinase K (New England Biolabs P8107S) (final concentration of 0.2 mg/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 units Terminal Transferase (New England Biolabs™) and were carried out at 37°C for 30 minutes followed by heat inactivation at 75°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 μL Proteinase K (New England Biolabs P8107S) (final concentration of 0.2 mg/mL ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 µL 10 mM ATP (NEB, Cat #P0756S), 40U (2 µL ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4 μL 10X rCutSmart buffer (NEB, B6004S) incubated at 72°C for 5 min) ...
-
bioRxiv - Microbiology 2021Quote: ... followed by nucleic acid purification and poly-adenylation of the cDNA with terminal transferase (NEB) for 30 minutes at 37 °C followed by 10 minutes heat-inactivation at 70 °C ...