Labshake search
Citations for New England Biolabs :
5901 - 5950 of 6023 citations for 7 Oxa 1 2 diazaspiro 4.4 non 1 en 6 one 4 methyl cis 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 uL each 10 uM forward and reverse primers (cTF223, cTF218 - see Supp. Table 2) and 25 uL NEBNext Q5U Master Mix (NEB, M0597) and ran the following thermocycling protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... The biotin handle and cosmid-I95 DNA were both digested for 2 h at 37 °C with SpeI-HF (New England Biolabs, R3133L) and subsequently heat-inactivated for 20 min at 80 °C ...
-
bioRxiv - Molecular Biology 2023Quote: Internally fluorescein-labelled RNA was produced by ligation of in vitro transcribed 5′ acceptor RNA fragment with chemically produced 3′ donor RNA containing internal fluorescein dT modification and 5′ monophosphate essential for ligase activity using T4 Ligase 2 (NEB #M0239S). Additionally ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Libraries were created using 1000ng of total RNA with the NEBNext Ultra 2 Directional RNA Library Kit following the Poly(A) mRNA Magnetic Isolation Module (NEB #E7490) and sequenced on an Illumina Hi-Seq 2000 ...
-
bioRxiv - Cell Biology 2024Quote: The plasmids used in this study were obtained from the sources as noted in Table 2 or made by either restriction digest and ligation or PCR and NEBuilder HiFi DNA assembly (New England Biolabs E5520S). Insert sequences were ordered as custom GeneBlocks from IDT or isolated from existing plasmids ...
-
bioRxiv - Genomics 2024Quote: ... Amplicons were then barcoded for NGS by combining 2 µL of amplicon from the previous PCR with 1X Q5 High-Fidelity Master Mix (New England Biolabs M0492) and 500 nM forward and reverse indexing primers (Integrated DNA Technologies) ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the BC-sgRNA1-sgRNA2 region from 32 μg of bulk lung genomic DNA using Q5 Ultra II High-Fidelity 2× Master Mix (New England Biolabs, M0494X). Unique dual-indexed primers were used to amplify each sample followed by purification using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Biophysics 2023Quote: Tau was phosphorylated in vitro according to previous protocols with some modifications.12,88 50 µL of 100 µM tau was incubated with 2 µg cAMP-dependent Protein Kinase (PKA, New England BioLabs P6000S) and/or 0.4 µg GSK3β (Sigma-Aldrich G4296 ...
-
bioRxiv - Cell Biology 2024Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA ligase 2 truncated KQ (NEB, M0373L). Linker-ligated RNA was reverse transcribed with Protoscript II (NEB ...
-
bioRxiv - Genomics 2023Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L).
-
bioRxiv - Neuroscience 2023Quote: ... Final nuclear lysates were resuspended using 100 µl of resuspension solution (1x PBS + 2% BSA + 0.2U/µl RNase inhibitor - New England Biolabs, Cat#: M0314S). Hoechst staining was performed to assess the quality of isolated nuclei based on their shape ...
-
bioRxiv - Pathology 2023Quote: ... cDNA then was used as a template for barcoding PCR following ONT’s protocol (SQK-LSK110 with EXP-PBC096) and LongAmp Taq 2× Master Mix (NEB, Ipswich, MA). The barcoded amplicons were bead purified at a 0.8× beads:solution ratio before being pooled by equal volume with libraries from unrelated samples and a library generated from HeLa RNA (ThermoFisher)
-
bioRxiv - Molecular Biology 2022Quote: ... pHAGE lentiviral plasmids encoding the six other HCoV N-EGFP were generated by replacing SARS-CoV-2 N with the respective HCoV N sequences by PCR (New England Biolabs M0492S) and NEBuilder HiFi DNA Assembly (New England Biolabs E2621S) ...
-
bioRxiv - Genetics 2023Quote: Library oligos for the prime editing screen were synthesized by Twist Bioscience and amplified using the NEBNext High-Fidelity 2× PCR Master Mix (NEB M0541L) with the forward primer GTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT and the reverse primer CTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGGTGTTAGG ...
-
bioRxiv - Biophysics 2023Quote: ... These plasmids were digested with NotI-HF and XhoI for 2 h at 37°C (R3189, R0146, New England Biolabs, UK) and heat-inactivated for 20 min at 80°C.
-
bioRxiv - Genomics 2023Quote: ... thirty 20 μl ePCRs were performed using 400 ng of DNA for each reaction and NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S) with the following primers ...
-
bioRxiv - Biochemistry 2023Quote: ... The mutant and wild-type target RNA were subsequently amplified using either the NEB Luna SARS-CoV-2 RT-qPCR Multiplex Assay Kit (NEB E3019), Luna Probe One-Step RT-qPCR 4X Mix with UDG (NEB M3019 ...
-
bioRxiv - Cell Biology 2022Quote: ... The mutant fragments were amplified by high-fidelity DNA polymerase 2 × Phanta Max Master Mix followed by DpnI (New England BioLabs; R0176S) digestion in 37°C for 1 hour to eliminate the templates ...
-
bioRxiv - Genetics 2023Quote: ... PCR products were analyzed on 2% Agarose gels with 0.5 ng/L Ethidium bromide using a 1kb Plus DNA Ladder (New England BioLabs Cat # N3200S) for size reference ...
-
bioRxiv - Genetics 2022Quote: ... and 2 μg of DNA was digested with 50 units of NlaIII and 5 μL CutSmart® Buffer (NEB, cat #R0125L), in a total volume of 50 μL ...
-
bioRxiv - Molecular Biology 2023Quote: ... All mRNAs were transcribed at 30°C for 2 hrs using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040S) and were co-transcriptionally capped (8:1 cap analog to GTP for ∼90% capping efficiency ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to linearize plasmid (10 µg) by incubating at 37 °C for a minimum of 2 hours in 1x CutSmart buffer (NEB, B7204S). Linearized plasmid was purified by extraction with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries were created using 1000ng of total RNA with the NEBNext Ultra 2 Directional RNA Library Kit following the Poly(A) mRNA Magnetic Isolation module (NEB #E7490). Libraries were sent to Novogene for Illumina Hi-Seq ...
-
bioRxiv - Developmental Biology 2023Quote: ... The 2-kpb cbln12 promoter (Dohaku et al., 2019) and lTl-Kaede-pAS were subcloned to pT2ALR-Dest by NEBuilder (NEB, USA). To generate Tg(5xUAS-hsp70l:HA-skor2-P2A-mCherry ...
-
bioRxiv - Plant Biology 2023Quote: ... and PEP444c were amplified using a cDNA template obtained from 2-week-old barley shoots and roots and Q5® High-Fidelity DNA Polymerase (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: Library oligos for the MYC enhancer screen were synthesized by Twist Bioscience and amplified using the NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), forward primer ...
-
bioRxiv - Genetics 2023Quote: ... were carried out with 3 nM of each DNA fragment from the master mix and 2 µL of the NEBridge Golden Gate Assembly Kit (BsaI-HFv2) (NEB E1601S) in 1X T4 DNA ligase Reaction Buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Amplification of target genes was carried out using a SYBR Green based qPCR mix consisting of Q5® High-Fidelity 2× Master Mix (NEB), SYBR Green ...
-
bioRxiv - Genomics 2023Quote: ... The gDNA is eluted with 25.2uL ddH2O and undergoes a second round of in vitro CpG methylation with previously described parameters above with exception that 10x Mg2+-free buffer is replaced with equal volume of NEB Buffer #2 (New England Biolabs, B7002S). The reaction is incubated again for 4 hours at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reactions were performed at 37°C for the indicated time (30 min if not otherwise specified) and then terminated by the addition of 10 μL of 2× RNA loading dye (New England Biolabs, USA). Reaction samples were heated at 85°C for 2 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Cancer Biology 2023Quote: ... 14-3-3ζ with different conjugated molecules and BAD variants conjugated with mCitrine were subcloned to the multiple cloning site (MCS-2) using EcoRI and XbaI (NEB; # R0145S) and the MCS-1 using MluI-HF (NEB ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and the targeted DNA region was amplified by PCR using the biomass as the template with the Q5™ High-Fidelity 2× master mix (New England Biolabs). Base-editing efficiency when targeting a plasmid-borne gene was estimated by isolating plasmid DNA upon 24-h editing treatment by using the NucleoSpin™ plasmid EasyPure kit (Macherey-Nagel ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos for side 1 and 2 were dimerized separately by mixing 9 μl of OligoA at 100 μM with 9 μl of OligoB at 100 μM and 2 μl of 10x DNA Ligase Buffer (NEB, M0202S) and heating to 95 °C for 5 minutes ...
-
bioRxiv - Zoology 2024Quote: ... The annealed dsRNAs (2.5 µg) were checked on 1.5% agarose gel by running them together with 2 µL of dsRNA ladder (NEB# N0363S, Germany) (Fig ...
-
bioRxiv - Cell Biology 2024Quote: RNA encoding indicated HSP90B1 nascent chains were prepared from PCR amplified and purified DNA template containing a T7 promoter and carried out at 37°C for 2 hours using the HiScribe® T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using the RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Synthetic Biology 2024Quote: Transcription templates for expressing gRNA variants and SARS-CoV-2 or CMV input RNA fragments were generated by PCR (Phusion high-fidelity PCR kit, NEB #E0553) of the gBlock or Ultramer template that included a T7 promoter and the gRNA or input RNA coding sequence ...
-
bioRxiv - Genetics 2024Quote: ... 250 ng of RNA samples were digested at 37°C for 2 hours with Nucleoside Digestion Mix (New England Biolabs, M069S). Digested RNA samples were diluted to 100 µl with double-distilled water and filtered through 0.22 µm Millex Syringe Filters ...
-
bioRxiv - Genomics 2024Quote: ... The reaction was purified using the Zymo DNA Clean & Concentrator kit and PCR-amplified with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and primers as defined in Corces et al ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... ddRAD library preparation included an initial digestion of 300 ng of DNA in a 34 μL reaction (2 hours at 37 °C; 10 U each of SbfI and MspI, New England Biolabs Inc.). Standard Illumina adapters were ligated using 60 cycles of digestion at 37 °C (2 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... Final nuclear lysates were resuspended using 100 µl of resuspension solution (1x PBS, 2% BSA, 0.2U/µl RNase inhibitor; New England Biolabs, cat# M0314S). Hoechst staining was performed to assess the quality of isolated nuclei based on their morphology ...
-
bioRxiv - Neuroscience 2024Quote: ... and Gas5 shRNAs (shRNA # 1= G5C1 and shRNA # 2= G5C2) were cloned by replacing the existing Luciferase shRNA (shRLuc) under a U6 promoter using BamHI (NEB #R0136L) and EcoRI restriction sites (Table 3) ...
-
bioRxiv - Biochemistry 2024Quote: ... and ligated to pre-adenylated linkers (NI-810 to NI-815) containing 5 nt sample barcodes unique for each sample using truncated T4 RNA ligase 2 (K227Q) (NEB; M0351L). Ligated fragments were separated from free linkers on a 15% polyacrylamide TBE-Urea gel and then pooled and purified for reverse transcription using RT primer NI-802 and ProtoScript II Reverse Transcriptase (NEB ...
-
bioRxiv - Genetics 2020Quote: For Southern blot analysis 150 ng of mouse DNA was digested with 10 units of BamHI-HF (NEB, Figure 2 and 5), NdeI (NEB ...
-
bioRxiv - Physiology 2020Quote: ... pNP152 was obtained by insertion of the sta-2 promoter and sta-2 gene fused to Lifeact::mKate2 [75] into the MosSCI vector pCFJ151 [76] using Gibson Assembly (NEB Inc., MA) and confirmed by PCR or sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... The probes were prepared by end labelling 10 pmoles of DNA oligonucleotide complementary to the sfRNA (Supplementary Table 2) with [γ-32P]-ATP (Perkin-Elmer, USA) using T4 polynucleotide kinase (NEB, USA) and purified from unincorporated nucleotides by gel filtration on Illustra MicroSpin G-25 Columns (GE Healthcare ...
-
bioRxiv - Plant Biology 2021Quote: ... nigrum young leaf and peduncle cDNA using c70979_Fw and c70979_Rv primer and cloned into the pEAQ-HT vector(50) using NruI-HF and SmaI restriction sites and 2× Gibson Assembly master mix (NEB, Ipswich, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... The relinearized single-stranded DNA template was subjected to PCR amplification by using barcoded primers for Illumina TrueSeq small RNA sample and Phusion High-Fidelity DNA Polymerase (2 U; M0530L, NEB, Ipswich, MA). Subsequently ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNAs were subcloned into vectors through conventional ligation with Ligation high Ver.2 (Toyobo, Osaka, Japan) or NEBuilder HiFi DNA Assembly (New England Biolabs, Ipswich, MA) according to the manufacturers’ instruction ...