Labshake search
Citations for New England Biolabs :
5751 - 5800 of 6023 citations for 7 Oxa 1 2 diazaspiro 4.4 non 1 en 6 one 4 methyl cis 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Proteins from the supernatant at 2 mg/mL were used for the Co-IP assay using Protein G magnetic beads (New England Biolabs) and a mouse monoclonal anti-HA antibody (Sigma) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR was done with 1-2 ng of plasmid and 200 nM of each primer in Phusion High-Fidelity PCR Master Mix (New England Biolabs) with pre-denaturation at 98°C for 5 sec followed by 12 cycles of 98°C for 5 sec ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 5 μl of the Phire PCR reaction was verified on a 2% agarose gel with a low molecular weight ladder (N3233S, NEB). 15 μl of PCR products were pooled and purified using PCR Purification Kit (D4013 ...
-
bioRxiv - Microbiology 2022Quote: ... Boiled tRNA was mixed with 12 μL PEG buffer mix (10 μL 50% PEG8000, 2 μL 10 × buffer B0216S; New England Biolabs). 3 μL of 5’ adenylated linkers (Table S3 ...
-
bioRxiv - Plant Biology 2022Quote: ... Libraries were size selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplification using Phusion DNA polymerase (NEB) for 15 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... multiplex qPCR was performed on a Bio-Rad C1000 Touch Thermal Cycler using Hot Start Taq 2× Master Mix (NEB) with HT_Forward and HT_Reverse primers (IDT ...
-
bioRxiv - Microbiology 2022Quote: ... Presence of SARS-CoV-2 RNA was determined by using CDC primers and probes with LunaScript RT Supermix Kit (NEB) run on BioRad (Hercules ...
-
bioRxiv - Molecular Biology 2022Quote: ... The end-repaired cDNA was ligated with 2 μL barcoded adaptor (100-466-000, Pacific Biosciences) with T4 DNA Ligase (M0202, New England Biolabs) in 50 μL reaction volume at room temperature for 1 hour ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a double HA tagged NanoLuc to the genomic locus was reintroduced into MluI linearized pCRIS-PITChv2 vectro backbone with NEBuilder 2× HiFi assembly (New England Biolabs)51.
-
bioRxiv - Molecular Biology 2022Quote: ... This PCR product was then introduced in MluI linearized pCRIS-PITChv2 vector via NEBuilder 2× HiFi assembly (New England Biolabs). Primers containing 20 to 22 bp homology regions corresponding to the genomic locus 5’ and 3’ of the sgRNA cleavage were used to PCR this cassette ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Biophysics 2024Quote: ... cDNA (2 μl) was used as template in 50 μl PCR reaction with Phusion Hot start flex (New England Biolabs). Reaction conditions ...
-
bioRxiv - Plant Biology 2024Quote: ... with 2 µg of the freshly synthetized SgRNA1 obtained with the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB). DNA repair templates containing the fenhexamid resistance cassette surrounded by 60 bp of the target gene for HR were obtained by PCR ...
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Immunology 2023Quote: ... Completed libraries were then sequenced to an average depth of approximately 20M reads per sample on a partial lane of the NovaSeq6000 S4 XP flow cell using 2×150 paired-end reads with 10-base dual indexes (CAS: E6440S, NEB). After demultiplexing these samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nicks were sealed by adding 10 μL 10x T4 DNA ligase buffer and 2 μL T4 DNA ligase (New England Biolabs) and incubating overnight at 16°C ...
-
bioRxiv - Microbiology 2024Quote: ... The SV40 NLS was added to the C-terminus of CypA via annealing partially complimentary primers encoding the SV40 NLS (Table S1) at 20 μM with NEB buffer 2 (New England Biolabs) at 95° C for 4 min and 70° C for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... Four PCR fragments of around 2,700 nucleotides long were generated from cDNA using primer pairs (Suppl. Table S2) with NEB Q5 Hot-Start high-fidelity 2× Master Mix (New England Biolabs). Fragments were gel-purified with MinElute gel extraction Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Pathology 2023Quote: Total RNA extracted from hearts of Ctrl and Eprs1cKO-homoat 2 weeks post tamoxifen injection were treated with DNase I (NEB) to remove potential genomic DNA in the RNA samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2) library for miRNAs detection utilizing NEBNext® Small RNA Library Prep Set for Illumina (New England Biolabs (UK) Ltd ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were then size selected for cDNA target fragments of 200–300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Genomics 2024Quote: ... The purified scaffold insert (2 ng) was ligated with the digested intermediate plasmid library vector (200 ng) using T4 DNA Ligase (NEB) at room temperature for 45 min ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were then size-selected for cDNA target fragments of 200–300 bp on 2% Low Range Ultra Agarose followed by PCR amplification using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Microbiology 2024Quote: ... 2 kb fragments upstream and downstream of SrcF were PCR amplified with Q5 High Fidelity DNA Polymerase (New England Biolabs) and cloned in PCR amplified pEx-deletion-ermG via DNA Gibson assembly (HiFi DNA Assembly Master Mix ...
-
bioRxiv - Biochemistry 2024Quote: Fab Fragments were generated by taking .5 mg of IgG and digesting with 2 µL of Lys C (NEB#P8109S) at 37℃ ...
-
bioRxiv - Biochemistry 2024Quote: ... After 30 mins the samples were placed on ice and 2 μl loading dye (Purple gel loading dye, no SDS, B7025 New England Biolabs) was added prior to loading 12 μl onto a 1.5% 15 x 15 cm 100 ml 0.5X TB agarose gel ...
-
bioRxiv - Biochemistry 2023Quote: ... Libraries were size selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Cell Biology 2024Quote: ... each lysed by incubation in 1000 μL RIPA buffer + 2 mM PMSF + 60 μL PIC + 112.5 Kunitz Unit/mL DNase I (RNase-free, NEB M0303) + 2.5 mM MgCl2 (Sigma 5985-OP ...
-
bioRxiv - Molecular Biology 2023Quote: ... The SNAP-tagged histones neosynthesized during the chase time were then pulse-labelled by incubating cells with 2 μM of the red-fluorescent SNAP reagent SNAP-cell TMR star (New England Biolabs) for 15 min at 37°C ...
-
bioRxiv - Genetics 2022Quote: ... 2 μg of DNA was digested with 50 units of DpnII and 5 μL NEBuffer™ DpnII (NEB, cat #R0543L), in a total volume of 50 μL ...
-
bioRxiv - Biochemistry 2023Quote: Transcription reactions were prepared at room temperature in 20 µL transcription buffer (40 µM Tris-HCl pH 8, 5 mM DTT, 10 mM MgCl2) with 2 mM NTP’s (NEB, N0450S) and 40 U/µL RNasin™ Plus (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 mM each of forward and reverse primers (Supplemental Table 2) and 0.5 U Phusion® HF DNA polymerase (NEB) in a reaction volume of 25 μl ...
-
bioRxiv - Neuroscience 2022Quote: ... 100 cells were isolated directly into low protein binding eppendorfs containing 2 ul NEBNext Single Cell Lysis Buffer (NEB, E5530S). Samples were kept on dry ice until transfer to −80 C for overnight storage.
-
bioRxiv - Microbiology 2023Quote: ... Samples were boiled for 10 min and 2 μL of 20 mg/ml proteinase K (New England Biolabs, Cat. #P8107S) were added ...
-
bioRxiv - Microbiology 2023Quote: ... Boiled tRNA was mixed with 12 μL PEG buffer mix (10 μL 50% PEG8000, 2 μL 10 × buffer B0216S; New England Biolabs). 3 μL of 5’ adenylated linkers (Supplementary Table 4 ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... grk-2 cDNA corresponding to the C-terminal GRK-2 fragment was amplified from a mixed-stage N2 cDNA library using Q5 high-fidelity DNA polymerase (NEB) with gene-specific primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Cell Biology 2023Quote: ... the repair vector GW209_pCRIS-PITChv2-C-dTAG-Puro (BRD4) (2 μg) was digested with MluI-HF (New England Biolabs; #R3198) in Cutsmart Buffer for 1 hour ...
-
bioRxiv - Bioengineering 2023Quote: ... The 2 pairs of ends were then ligated simultaneously to the linearized plasmid using T4 DNA Ligase (New England Biolabs:M0202) at 2 U/pmol DNA ends in 1x T4 ligase buffer (provided with enzyme) ...
-
bioRxiv - Genetics 2023Quote: ... the region containing the target surrounded by the context was amplified by PCR using primers P7-P8 with Q5 Hot Start High-Fidelity 2× Master Mix (NEB) with the following conditions ...
-
bioRxiv - Genomics 2023Quote: ... ninety-six 20 μl ePCR reactions were performed using 0.01 fmol of pooled oligos with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S). Each 20 μl PCR mix was combined with 40 μl of oil-surfactant mixture (containing 4.5 % Span 80 (v/v) ...
-
bioRxiv - Microbiology 2023Quote: ... concisus for 2 h at 37°C in presence of 0.4 mM S-Adenosylmethionine (SAM, New England Biolabs, Ipswich, MA). After methylation ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA was eluted from the oligo-dT beads and fragmented by incubating with the First Strand Synthesis Reaction buffer and Random Primer Mix (2×) from the NEBNext Ultra II Directional Library Prep Kit for Illumina (#NEBE7760; New England Biolabs) for 15Lmin at 94°C ...
-
bioRxiv - Genomics 2023Quote: ... followed by the addition of 22 µL of ligation mix (20 µL quick ligase buffer and 2 µL of quick ligase, NEB) and incubation at 25°C for 10 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 250 ng Golden Gate vector (pcDNA3-based carrying a twin Strep-FLAG tag, synthesized by BioCat, Heidelberg, Germany) 2 U BSA HFv2 (NEB), 1 U T4 ligase (NEB ...
-
bioRxiv - Immunology 2022Quote: ... 2 µl preramp PCR product was mixed with 48 µl tagging PCR mix (10 µl 5x phusion HF buffer (NEB); 1 µl Phusion Hot Start II DNA Polymerase (2U/ µl ...