Labshake search
Citations for New England Biolabs :
5601 - 5650 of 6023 citations for 7 Oxa 1 2 diazaspiro 4.4 non 1 en 6 one 4 methyl cis 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... All mutants (Arp2D subdomain 2 swap, Arp2D-2CT, and Arp2-2DCT) were generated using Q5 site-directed mutagenesis (NEB). All genes were cloned into a vector encoding an attB site and superfolder GFP under the control of an eye-specific promoter (3XP3) ...
-
bioRxiv - Developmental Biology 2023Quote: ... A primer set annealing to the amplification sequences was used at a final concentration of 0.5 μM to amplify the pool of oligonucleotides using 12.5 μL 2 x NEBnext PCR master mix (New England BioLabs) and 3 μL of oligonucleotide pool (∼3 ng) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of iTP_3’_linker_ApoI (10 μM) and 0.5 μl of ligase (T4 RNA ligase 2, truncated - 200 000 U/ml - New England Biolabs) per reaction ...
-
bioRxiv - Biochemistry 2023Quote: Approximately 100 µg of extracted protein was incubated with 2 µL (1,000 U) of PNGase F (New England Biolabs) at 37°C for 48 hrs ...
-
bioRxiv - Genetics 2023Quote: ... Input genomic DNA was first amplified in a 10μL reaction for 30 cycles using NEBNext High-Fidelity 2×PCR Master Mix (NEB). Amplicons were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µL i7 unique index primer (10 µM) and 25 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB) and subjected to the following PCR program ...
-
bioRxiv - Microbiology 2023Quote: The pGEX-6P-PrkA1-338 plasmid (Table 2) was constructed by a two-part ligation (NEB Quick Ligation kit) of BamHI- and NotI-linearized pGEX-6P and PCR-generated prkA1-338 amplified with primers AS21 and AS81 (Table 3 ...
-
bioRxiv - Genomics 2023Quote: ... we amplified pegRNA/ngRNA pair sequences from each sample using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and the following primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... To produce the ABI1 Isoform 2 deleted SH3 domain we performed Q5 site-directed mutagenesis (New England Biolabs Inc.) with forward primer 5’-TAGCTCGAGGTTAACGAATTC - 3’ and reverse primer 5’-TTTCTCAATATAATTCTTGGGG - 3’ synthesized by IDT and then verified the sequence (Genewiz) ...
-
bioRxiv - Microbiology 2023Quote: ... Amplified PCR products were ran on 2% agarose gel and stained with ethidium bromide solution (New England Biolabs Inc.). Gel photographs were taken using ChemiDoc MP gel documentation system (BIO-RAD).
-
bioRxiv - Microbiology 2023Quote: ... was ordered and cloned into the pCG1-SARS-2BA.2 vector via Gibson assembly according to the manufacturer’s instructions (New England Biolabs). To this end the pCG1-SARS-2-BA.2 vector was amplified by PCR using appropriate primers (GTGCCATTGGTGCCGGACACG and CACCAGCCTTACAGAGTGG ...
-
bioRxiv - Bioengineering 2023Quote: ... and assembled with PCR amplified (primers 2 and 3) pRSET vector fragment using Gibson assembly (NEB Japan, Tokyo, Japan) to add T7 promoter ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 0.5 μl of 100 mM phenylmethylsulfonyl fluoride] and incubated with micrococcal nuclease (2 × 103 U/ml; New England Biolabs) for 2 hours at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Single cells of two untreated CeD patients were sorted into 96-well plates containing 2 µl of scRNA-seq catch buffer (0.2% vol/vol Triton X-100 [Sigma] in H2O with 2 U/μl RNase inhibitor [New England Biolabs]) per well using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Immunology 2023Quote: ... and ligated with custom UMI adapters (IDT) (Table S2) at 2 uM according to NEBNext Ultra II instructions (NEB). Libraries were prepped following NEBNext Immune Sequencing Kit’s protocol (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR products were digested with 0.4 μl of restriction enzyme NlaIII for 2 hours at 37°C (New England Biolabs). Digested PCR products were run on 2% agarose gels with SYBR Safe (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... for the elution from the columns 2 pg of Tn5-digested and purified lambda DNA (New England Biolabs, # N3011S) were added to be used as spike-in normalizer for later analysis ...
-
bioRxiv - Genomics 2024Quote: ... 2 µg of the plasmids containing the reporters and promoters (pJL206 or pJL261) were linearized with BciVI (NEB, R0596S) for 1 h at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR fragments were cloned into psiCHECK-2 using the restriction enzymes XhoI/NotI or SglI/NOTI (New England Biolabs). Ligations were performed with a quick ligation kig (New England Biolabs ...
-
bioRxiv - Immunology 2024Quote: ... Samples were then processed for library barcoding and amplification with Q5 High-Fidelity 2× Master Mix (cat. M0492S, NEB). Prepared libraries were sent for sequencing after quantification using Qubit and size distribution as determined using an Agilent 4200 TapeStation.
-
bioRxiv - Microbiology 2024Quote: ... The RT RNA sample (5 μL) was amplified using the LongAmp Taq 2× Master Mix (NEB, Ipswich, MA, USA) with IVT Nanopore T7 Fw and IVT Nanopore T7 Rv primers (Supplementary Table 5) ...
-
bioRxiv - Cell Biology 2024Quote: ... 100 pmol forward oligo and 100 pmol reverse oligo were resuspended in 25 μL 1x NEBuffer 2 (NEB, B7002S). The solution was incubated in a 95 °C water bath for 4 min then slowly cooled (∼0.5 °C/min ...
-
bioRxiv - Biochemistry 2024Quote: ... The reaction mix was incubated at 37°C and 15 ul aliquots were removed at indicated time points, quenched into stop buffer (1.8% SDS, 10 mM EDTA) followed by Proteinase-K (2 units total) (NEB) treatment for 45 min at 50°C ...
-
bioRxiv - Plant Biology 2024Quote: ... when OD600 reached 0.5 for 4 h at 37 °C and then they were purified using amylose resin column (New England Biolabs, for MBP related proteins purification) or Ni-NTA agarose column (Qiagen ...
-
bioRxiv - Physiology 2020Quote: ... Membranes were washed with TBS-T and then incubated with an anti-rabbit horseradish peroxidase conjugated secondary antibody (New England Biolabs, 1:10,000 in 5% skim milk in TBS-T) for 2h ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were incubated at 37°C and stopped for indicated time periods and the reaction was stopped by addition of 2 × RNA loading dye (New England Biolabs). For electrophoresis ...
-
bioRxiv - Genetics 2021Quote: ... input genomic DNA was amplified in a 20 μL reaction for 25 cycles using NEBNext High-Fidelity 2× PCR Master Mix (NEB). PCR products were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2021Quote: ... The protein was buffer exchanged into enterokinase cleavage buffer (20 mM Tris pH 8, 50 mM NaCl, 2 mM CaCl2) and cleaved using bovine enterokinase (EK, NEB) at 16U/mg protein for 4 hrs ...
-
bioRxiv - Microbiology 2020Quote: ... This gBlocks fragment and a NdeI-HindIII-digested pET21b backbone were assembled together using a 2× Gibson master mix (NEB). Gibson assembly was possible due to a 23-bp sequence shared between the NdeI-HindIII-cut pET21b backbone and the gBlocks fragment ...
-
bioRxiv - Microbiology 2020Quote: ... Two and a half μL of each fragment at equimolar concentration was added to 5 μL 2× Gibson master mix (NEB), and the mixture was incubated at 50°C for 60 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA (2 μL) was used as template in 50 μL PCR reaction with Phusion Hot start flex (New England Biolabs). Reaction conditions ...
-
bioRxiv - Genomics 2020Quote: ... Beads containing the ssDNA extension products were suspended in 10 μl of polyadenylation master mix containing 2 units of terminal transferase TdT (New England Biolabs), 1x TdT buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAse I digestion to analyse 2’-O-ribose methylation was done in the presence of 10 U T4 PNK (NEB) in 50 mM Tris-acetate (pH 6.5) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gluc200 and Gluc200A44 templates were generated using PCR amplification of GLuc of the first 200 nt at the 5’end of pCMV-GLuc 2 Control Plasmid (NEB: https://www.neb.com/tools-and-resources/interactive-tools/dna-sequences-and-maps-tool) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Labelling of total histones was performed by a 30 min-pulse with 2 µM of the SNAP-cell SiR-647 reagent (New England Biolabs) followed by 30 min wash in fresh medium.
-
bioRxiv - Molecular Biology 2020Quote: ... The SNAP-tagged histones neosynthesized during the chase time were pulse-labeled by incubating cells with 2 μM of red-fluorescent SNAP reagent (SNAPcell TMR star, New England Biolabs) for 15 min at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... after incubating the samples with 2 μl of RNase A (Thermo) at 37 °C for 2h and then with 8 μl of proteinase K (NEB) at 55 °C for 4h ...
-
bioRxiv - Molecular Biology 2021Quote: A CD22 cDNA fragment encoding the first two Ig-like domains fused to an EK-hIgG-Fc fragment was amplified by PCR and cloned into the mammalian expression vector pACP-tag(m)-2 (New England Biolabs).
-
bioRxiv - Molecular Biology 2019Quote: ... followed by the insertion of a DNA fragment containing C-terminal 2×HA tag by NEBuilder HiFi DNA Assembly Master Mix (NEB). Finally ...
-
bioRxiv - Genomics 2020Quote: ... The gRNA was ordered as a single stranded oligo gblock from IDT and amplified using 2 50 uL reactions of Q5 High Fidelity 2X Master Mix (NEB). Cells were transfected with 0.5 ug gRNA gblock and 2.5 ug px458 plasmid (Addgene plasmid # 48138 ...
-
bioRxiv - Genomics 2020Quote: Synthetic SARS-CoV-2 RNA templates were serially diluted and amplified by RT-LAMP using the WarmStart LAMP Kit (NEB). LAMP primers were added to a final concentration of 0.2µM for F3 and B3 ...
-
bioRxiv - Molecular Biology 2021Quote: Plasmid mutagenesis to create SARS-CoV-2 mutant genes was achieved using the Q5® Site-Directed Mutagenesis (SDM) Kit according to the manufacturer’s instructions (NEB) or by using Gibson assembly with mutations introduced into the complementary overhang regions of the primer sequences ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 25mer Cap 1 RNA was generated by treating the chemically synthesized 3’-FAM-labeled Cap 0 25mer RNA with mRNA Cap 2’-O-Methyltransferase (NEB) in the presence of SAM ...
-
bioRxiv - Molecular Biology 2019Quote: ... The reactions were incubated for 60 minutes at 37 °C and terminated by the addition 2 μL of Proteinase K (NEB) which had been supplemented with 0.1 reaction volume of 1 M Tris-HCl pH 8.0 ...
-
bioRxiv - Biochemistry 2020Quote: ... small RNA library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 2) (NEB). cDNA libraries were sequenced on a HiSeq2000 platform in a spike-in format in paired-end 50 (PE50 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... DNA oligonucleotides were diluted (and mixed) to the desired concentration in buffer solution with 2 mg/mL BSA (Molecular Biology Grade, New England Biolabs) to minimize DNA adsorption to tubing and pipette tips and loaded to inlet port 3 ...
-
bioRxiv - Microbiology 2019Quote: ... and family 2 baby 10 month) we performed enrichment with the NEB Next Microbiome Enrichment Kit (New England Biolabs, www.neb.com) and sequenced both the pre-enrichment and post-enrichment samples ...
-
bioRxiv - Developmental Biology 2019Quote: ... A short stretch of genomic region (∼600-800 bp) flanking the target site was amplified using Q5 Hot Start High Fidelity 2 × Master Mix (NEB). Amplified sequences were purified with the QIAquick PCR purification kit (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: DNA was extracted from embryonic membranes or tail tissue using the HotShot method for 15 minutes (Truett et al., 2000) and 2 µl DNA was used for PCR with Phusion polymerase (New England Biolabs). For Geminin and Cre PCRs ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2 μl of the assembled mix (∼5 ng of vector backbone) was transformed into competent cells (NEB, cat# C2987H), followed by spreading on antibiotic-selective LB agar plates ...