Labshake search
Citations for Illumina :
1 - 50 of 1063 citations for PCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... PCR master mix containing NPM PCR mix (Illumina), 1X SYBR Green dye and uniquely indexed PCR primers were added to each well ...
-
bioRxiv - Immunology 2021Quote: ... 25 μl PCR master mix (Nextera, Illumina) and 5 μl indexed amplification primers59 (0.125 μM final concentration ...
-
bioRxiv - Immunology 2021Quote: ... Add 30 μl PCR master mix (2.5 μl Illumina dual indexes primer 1 ...
-
bioRxiv - Genomics 2023Quote: ... 12.5 μl of a master mix containing 7.5 μl of Nextera PCR Master Mix (Illumina, FC-131-1096) and 2.5μl of each Index primer i7 (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... 10 ng of DNA template was combined with PCR master mix (0.2 mM dNTP mix, 0.56 mg/ml BSA, 0.4 uM Illumina adapter sequence-tagged forward primer (515F ...
-
bioRxiv - Cell Biology 2022Quote: ... 10μl of the tagmented chromatin was mixed with 2.5μl of Nextera PCR primer cocktail and 7.5μl of Nextera PCR master-mix (Illumina FC-121-1030) in low-binding PCR tubes ...
-
bioRxiv - Microbiology 2020Quote: ... Tagmented DNA fragments were enriched by 10 cycles of PCR amplification using PCR master mix and primers with the index from Illumina. Libraries were quantified by the KAPA SYBR fast quantitative PCR kit (Life Technologies ...
-
bioRxiv - Genetics 2023Quote: ... dsODN specific PCR products were used for indexing PCR using 2x Platinum SuperFi PCR Master mix and i5 primer: AATGATACGGCGACCACCGAGATC and i7 indexing primers (Illumina) following the cycling conditions ...
-
bioRxiv - Neuroscience 2021Quote: ... Then the tagmented DNA was indexed and amplified with 3.75 µL of PCR master mix (Illumina) and 1.25 µL each of i5 and i7 indexing primers (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... Add 30 μl PCR master mix (2.5 μl Illumina dual indexes primer 1, 2.5 μl Illumina dual index primer 2 ...
-
bioRxiv - Immunology 2021Quote: ... Transposed DNA fragments were purified using Qiagen Mini- Elute Kit and PCR amplified using NEB Next High Fidelity 2x PCR master mix (New England Labs) with dual indexes primers (Illumina Nextera). Genomic Alignment of sequencing reads ...
-
bioRxiv - Cell Biology 2023Quote: ... qRT-PCR was conducted using AceQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) on an RT-PCR system (Illumina Eco, California, USA). The primers used are listed in Table 1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 25 mL of 2x NEBNext Ultra II Q5 Master Mix, 3 mL of 10 mM Universal PCR primer from Illumina, 3 mL of 10mM Index PCR primer and 9 mL of nuclease-free water and amplified for 10 cycles (98C for 10 s ...
-
bioRxiv - Cancer Biology 2023Quote: ... we performed single-nucleus indexing by dispensing 600 nL of Nextera PCR Master Mix (NPM) and 400 nL of a unique Nextera index pair (Illumina, cat ...
-
bioRxiv - Cancer Biology 2021Quote: ... 7.5 μL NPM PCR mix (Illumina), 4 μL distilled water ...
-
bioRxiv - Genetics 2019Quote: ... The libraries were amplified using the NPM mix (Nextera PCR Master Mix from Nextera DNA Library Prep Kit) and Index adapters i7 and i5 (Nextera Index Kit, Illumina, U.S), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The beads were resuspended in 50 μl of the following PCR master mix with indexed primers from the Nextera DNA Sample Preparation Index Kit (Illumina, FC-121-1011): Phusion HF 2X (NEB ...
-
bioRxiv - Immunology 2021Quote: ... Cells were suspended in 50 uL of tagmentation master mix prepared from Illumina Tagment DNA TDE1 Enzyme and Buffer Kit components (#20034197) ...
-
bioRxiv - Cell Biology 2022Quote: ... and quantified by qPCR using the KAPA SYBR Fast qPCR Master Mix (Illumina). Paired- end single cell 3’ gene expression libraries were sequenced on a Novaseq 6000 System (Illumina ...
-
bioRxiv - Immunology 2022Quote: ... cDNA libraries were amplified 12 cycles of PCR with Terra PCR Direct polymerase Mix in the presence of i5 or i7 PCR primers (Illumina) to add sample specific indexes ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR samples contained 11.2 μL of KAPA polymerase mix (Illumina), 4.4 μL each of the 5 μM column and row indexing primers ...
-
bioRxiv - Genomics 2022Quote: ... 10 units of T4 PNK (NEBNext® DNA Library Prep Master Mix Set for Illumina, #E6040L) were added to the blunt-ended DNA in NEBNext End Repair Reaction Buffer (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 µL of Enhanced PCR Mix (supplied with an Illumina DNA Prep kit), and 27.5 µL of water ...
-
bioRxiv - Neuroscience 2024Quote: ... sequencing adaptors P5 and P7 were introduced following the 10xGenomics dual-index setup: 20-50ng PCR product was added to library PCR mix (50% KAPA, 10% Betaine, 20% primer Dual index (Illumina)) ...
-
bioRxiv - Neuroscience 2024Quote: ... sequencing adaptors P5 and P7 were introduced following the 10xGenomics dual-index setup: 20-50ng PCR product was added to library PCR mix (50% KAPA, 10% Betaine, 20% primer Dual index (Illumina)) total 20µl ...
-
bioRxiv - Neuroscience 2024Quote: ... sequencing adaptors P5 and P7 were introduced following the 10xGenomics dual-index setup: Eluted PCR product was added to library PCR mix (50% KAPA, 10% Betaine, 20% primer Dual index (Illumina)) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The samples were then transferred on to the ice and the components (15 μl Blunt ligase master mix, 2.5 μl NEB Next adaptor for Illumina, and 1 μl ligation enhancer to a total volume of 83.5 μl ...
-
bioRxiv - Genomics 2021Quote: ... 30 μL of NEBNext Ultra II Ligation Master Mix, 1 μL of NEBNext Ligation Enhancer, 2.5 μL of NEBNext Adapter for Illumina) at 20 °C for 15 min. ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were resuspended in cold PBS and tagmentation master mix (25 ul of 2x tagmentation buffer, 2.5 ul of TDE1 [Illumina] ...
-
bioRxiv - Microbiology 2023Quote: ... 1 U PCRBIO HiFi Polymerase (PCR Biosystems) and 10 µL of Nextera adaptor mix (Illumina). PCR conditions were 95°C ...
-
bioRxiv - Genetics 2019Quote: ... Second-strand cDNA synthesis was used to assemble a library and sequenced following the manufacturer’s instructions (NEB Next DNA Library Prep Master Mix Set for Illumina; NEB E6040L). Sequenced reads were aligned to the human reference genome hg19 using TopHat v2.1.0 with the ‘--no-coverage-search --read-realign-edit-dist 0’ option selected (17) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The libraries then were amplified using PCR Enhancer mix and primer cocktail (Illumina, FC-121-4001) for 12 cycles ...
-
bioRxiv - Molecular Biology 2022Quote: ... and subsequently amplified by PCR using KAPA HiFi Hotstart Ready Mix and Nextera Index Kit (Illumina) primers ...
-
bioRxiv - Genomics 2022Quote: ... all of the ChIP DNA and 220 ng of input DNA were mixed with 3 units of T4 DNA polymerase (NEBNext® DNA Library Prep Master Mix Set for Illumina, #E6040L) to create blunt ends ...
-
bioRxiv - Genomics 2019Quote: ... the nuclei pellets were resuspended in transposase Master Mix (1.25 μl 10x TD buffer, 5 μl H2O and 6.5 μl of Tn5: Illumina Nextera Kit; FC-121-1031) and incubated for 30 minutes at 37°C ...
-
bioRxiv - Genetics 2020Quote: ... Plates were immediately transferred to ice post-incubation and 12 μL of PCR mix (7.5 μL NPM [Illumina Inc ...
-
bioRxiv - Neuroscience 2022Quote: ... Transcriptomic profile of individual BAT samples was performed using commercial RNA-sequencing kits (NEBNext mRNA Library Prep Master Mix and NEBNext Multiplex Oligos for Illumina, New England Biolabs, Ipswich, MA) and adapted according to previous descriptions [22] ...
-
bioRxiv - Immunology 2022Quote: ... Purified DNA was further amplified by PCR using Kapa Hifi Hotstart Ready Mix with Nextra XT Index Primers from Nextra XT Index Kit (Illumina). The PCR condition was ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR reactions were performed using the Thunderbird® SYBR qPCR mix (TOYOBO) and Eco Real-Time PCR System (Illumina). The PCR primers used are listed in Supplementary Table S8 ...
-
bioRxiv - Cell Biology 2020Quote: ... Fragment Mix (Illumina). End repair ...
-
bioRxiv - Molecular Biology 2020Quote: ... finish mix’ (Illumina). Sequencing libraries were prepared using Truseq stranded RNA LT kit (Illumina ...
-
bioRxiv - Genetics 2021Quote: 5× HOT FIREPol® EvaGreen® qPCR Mix Plus with ROX (Solis Biodyne) and an Eco Real-Time PCR System (Illumina) were used for qPCR ...
-
bioRxiv - Physiology 2024Quote: ... tagmented DNA was amplified by PCR in a reaction mix (5 µL DNA, 2.5 µL of 25 μM forward primer (Nextera/Illumina i5 adaptors (Illumina)) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Fragment Mix (EPF, Illumina). End repair ...
-
bioRxiv - Physiology 2021Quote: ... Fragment High Mix (Illumina) and then subjected to first strand cDNA synthesis with 1 µl Superscript III reverse transcriptase (Life Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... RT-qPCR gene expression quantifications were performed using AceQ qPCR SYBR Green Mix (Vazyme Biotech) on Eco Real-Time PCR System (Illumina, San Diego, CA). RNA expression was normalized to a geometric mean of two reference genes ...
-
bioRxiv - Genomics 2020Quote: ... Nextera Amplicon Tagment Mix (Illumina); Terra™ PCR Direct Polymerase Mix ...
-
bioRxiv - Genomics 2020Quote: ... and Nextera NPM mix (Illumina). Human samples were similarly indexed via PCR using custom ...
-
bioRxiv - Neuroscience 2021Quote: ... Prime and Fragment Mix (Illumina). End repair ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Fragment Mix from Illumina.