Labshake search
Citations for Illumina :
651 - 700 of 9336 citations for Mouse Direct PCR Kit For Genotyping since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... Illumina BeadArrays (mouse WG-6, Illumina) were used to profile the transcriptome of 33 independent EpiSC samples ...
-
bioRxiv - Microbiology 2019Quote: ... 5 μg of bacterial RNA was treated for ribosomal RNA (rRNA) removal by using a Ribo-Zero rRNA Removal Kit (Mouse and Bacteria) (Illumina Inc., San Diego, CA). Directional RNA-seq libraries were created using TruSeq RNA Sample Prep Kit v2 (Illumina Inc.) ...
-
bioRxiv - Immunology 2023Quote: ... alpha/beta libraries were prepared on 100 ng of RNA from each sample using the SMARTer Mouse TCR α/β Profiling Kit from Takarabio® and sequenced using the MiSeq V2 2×150bp (Illumina®) and HiSeq2500 V2 2×150bp (Illumina® ...
-
bioRxiv - Microbiology 2020Quote: ... A second PCR was performed to attach dual indices and Illumina® sequencing adapters using the Nextera XT Index kit (Illumina®; San Diego, CA, USA). The conditions of this PCR included ...
-
bioRxiv - Cell Biology 2020Quote: ... The PCR products were purified using Expin™ PCR SV mini (GeneAll) and sequenced using a MiniSeq Sequencing System (Illumina). The results were analyzed using Cas-Analyzer (http://www.rgenome.net/cas-analyzer/ ...
-
bioRxiv - Neuroscience 2021Quote: ... Universal adapters were ligated followed by 10 cycles of PCR using Illumina PCR Primer Cocktail and Phusion DNA polymerase from Illumina. Subsequent library purification with Agencourt AMPure XP beads was validated with Agilent Bioanalyzer 2100 ...
-
Therapeutic base and prime editing of COL7A1 mutations in recessive dystrophic epidermolysis bullosabioRxiv - Bioengineering 2021Quote: ... The PCR products were purified using Expin™ PCR SV mini (GeneAll) and sequenced using a MiniSeq Sequencing System (Illumina). The results were analyzed using Cas-Analyzer (http://www.rgenome.net/cas-analyzer/) ...
-
bioRxiv - Microbiology 2020Quote: ... Tagmented DNA fragments were enriched by 10 cycles of PCR amplification using PCR master mix and primers with the index from Illumina. Libraries were quantified by the KAPA SYBR fast quantitative PCR kit (Life Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... the 309 bp sequence of the nodD coding region was amplified by PCR from the DNA extractions and the PCR products were sequenced by Illumina MiSeq 2×250 bp technology as described in Methods S5 ...
-
bioRxiv - Genetics 2023Quote: ... dsODN specific PCR products were used for indexing PCR using 2x Platinum SuperFi PCR Master mix and i5 primer: AATGATACGGCGACCACCGAGATC and i7 indexing primers (Illumina) following the cycling conditions ...
-
bioRxiv - Bioengineering 2023Quote: ... The DNA fragments around the crRNA target site were amplified by a two-step PCR with specific primer sets (Table S2) and Index PCR Primers mentioned in the manufacturer’s instructions (Illumina, USA). After gel purification ...
-
Measuring carbohydrate recognition profile of lectins on live cells using liquid glycan array (LiGA)bioRxiv - Biochemistry 2023Quote: ... The clonal phage was PCR amplified using a protocol described in “PCR Protocol and Illumina sequencing” and analyzed by Illumina sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.33 μL of the PCR product was then used for a second PCR reaction to attach the TruSeq UDI (Illumina) indexes ...
-
bioRxiv - Neuroscience 2024Quote: ... sequencing adaptors P5 and P7 were introduced following the 10xGenomics dual-index setup: 20-50ng PCR product was added to library PCR mix (50% KAPA, 10% Betaine, 20% primer Dual index (Illumina)) ...
-
bioRxiv - Neuroscience 2024Quote: ... sequencing adaptors P5 and P7 were introduced following the 10xGenomics dual-index setup: 20-50ng PCR product was added to library PCR mix (50% KAPA, 10% Betaine, 20% primer Dual index (Illumina)) total 20µl ...
-
bioRxiv - Neuroscience 2024Quote: ... sequencing adaptors P5 and P7 were introduced following the 10xGenomics dual-index setup: Eluted PCR product was added to library PCR mix (50% KAPA, 10% Betaine, 20% primer Dual index (Illumina)) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... individual 100bp TruSeq DNA PCR-free libraries (Illumina) were sequenced with Illumina HiSeq 2500 high-throughput paired-end sequencing technology at the Lausanne Genomic Technologies Facility (GTF ...
-
bioRxiv - Genomics 2020Quote: ... PCR amplification was performed using Nextera primers (Illumina) to make the libraries for deep sequencing.
-
bioRxiv - Cancer Biology 2020Quote: ... The resulting PCR products were sequenced by Illumina Hiseq 4000 and evaluated based on the known sgRNA targets sequence.
-
bioRxiv - Plant Biology 2020Quote: ... Library preparation (Illumina Shotgun TruSeq DNA PCR-free) and Illumina sequencing on a HiSeq X platform with a 150bp PE read length was performed by Macrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... Paired-end libraries (Illumina TruSeq DNA, PCR-free) were made according to the standard Illumina protocol ...
-
bioRxiv - Microbiology 2022Quote: ... The final PCR products were sequenced by Illumina MiSeq PE300.
-
bioRxiv - Genetics 2020Quote: ... single worm PCR products were analyzed by Illumina sequencing using 2×250 bp pair-end run ...
-
bioRxiv - Biochemistry 2021Quote: ... in an Eco Real-Time PCR System (Illumina). The following thermal cycling profile was used ...
-
bioRxiv - Cell Biology 2020Quote: ... All PCRs were pooled and sequenced by Illumina sequencing (Duke Center for Genomic and Computational Biology (GCB) ...
-
bioRxiv - Genetics 2021Quote: ... and a unique indexed RNA PCR primer (Illumina) per reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a unique indexed RNA PCR primer (Illumina) per reaction ...
-
bioRxiv - Developmental Biology 2023Quote: ... following Sequencing Protocol provided by Addgene (“Broad Institute PCR of sgRNAs for Illumina sequencing”). Next-generation sequencing was performed from the Molecular Pathology Genomics Core of Children’s Hospital Los Angeles using Illumina HighSeq 2500.
-
bioRxiv - Cell Biology 2023Quote: ... and a unique indexed RNA PCR primer (Illumina) per reaction ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cDNA template was PCR amplified (Illumina barcoding) for 12 cycles and size selected to 225–350 bp length ...
-
bioRxiv - Bioengineering 2020Quote: ... the V3-V4 hypervariable region of the bacterial 16S rRNA gene pool of the DNA extracts was amplified by PCR using the pair of 341f/806r primers prior to sequencing of PCR products using a HiSeq 2500 sequencer (Illumina, USA). A detailed description of the wet-lab and dry-lab workflows can be found in Supporting Information S5.
-
bioRxiv - Immunology 2021Quote: ... Transposed DNA fragments were purified using Qiagen Mini- Elute Kit and PCR amplified using NEB Next High Fidelity 2x PCR master mix (New England Labs) with dual indexes primers (Illumina Nextera). Genomic Alignment of sequencing reads ...
-
bioRxiv - Cell Biology 2023Quote: The PCR primers introduce the full-length adaptor sequence required for Illumina sequencing (for details see Illumina small RNA PCR primers). PCR was performed in 12.5 μL using half of the ranhexRT sample as a template [1× KAPA HiFi HotStart ReadyMix (KapaBiosystems KK2602) ...
-
bioRxiv - Plant Biology 2024Quote: ... After three rounds of PCR with specific primers (1stPCR: CARMA_3RACE and RTPXT, 2ndPCR: mXTf and mXTr, 3rd PCR: Illumina indexing primers) and cleaning each PCR reaction on AMPure beads ...
-
bioRxiv - Genetics 2023Quote: ... The mm10 mouse genome manifest from Illumina was used as reference ...
-
bioRxiv - Cell Biology 2022Quote: ... The quantitative 3-step real-time PCR was performed by the Eco Real-Time PCR system (Illumina Inc., San Diego CA, USA) and CFX Connect (Bio-Rad Laboratories AG ...
-
bioRxiv - Microbiology 2019Quote: ... The remaining contigs were amplified by PCR from the plasmid preparations that followed two iterations of SpyCas9 selection (those used in PCRs for Illumina library construction). PCR primers (table S6 ...
-
bioRxiv - Genetics 2020Quote: ... The first PCR used universal primers (without Illumina indexes) to amplify the barcodes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The 100 PCR samples were then sequenced by Illumina sequencing platform ...
-
bioRxiv - Microbiology 2022Quote: ... Library preparation (Illumina® TruSeq™ DNA PCR-Free), sequencing and quality checks were done by the Biomics sequencing platform of the Institut Pasteur (C2RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... by PCR amplification using Illumina sequencing adaptor primers (Illumina). Paired-end sequencing was performed on a Hi-Seq 2500 System (University of Georgia Genomics Core ...
-
bioRxiv - Microbiology 2022Quote: ... Library preparation (Illumina® TruSeq™ DNA PCR-Free) and sequencing was done on the C2RT Biomics platform of the Institut Pasteur (using short reads ...
-
bioRxiv - Neuroscience 2019Quote: ... the amplification (cDNA and PCR) and sequencing primers (Illumina) and the low-quality bases were removed using Trimmomatic 0.35 software 63 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Clones were screened by PCR and Miseq sequencing (Illumina).
-
bioRxiv - Biochemistry 2021Quote: ... PCR amplicons were purified and sequenced (NextSeq 500, Illumina). Screens were analyzed using Python (v.2.7.13) ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR amplicons were purified and sequenced (NextSeq 500, Illumina). Screens were analyzed using Python (v.2.7.13) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification followed Earth Microbiome Project recommendations (“16S Illumina Amplicon Protocol ...
-
bioRxiv - Immunology 2021Quote: ... Add 30 μl PCR master mix (2.5 μl Illumina dual indexes primer 1 ...
-
bioRxiv - Immunology 2021Quote: ... PCR products were barcoded and sequenced utilizing MiSeq (Illumina) Nano kit v.2 as described in [84].
-
bioRxiv - Cancer Biology 2022Quote: ... Purified PCR products were sequenced using HiSeq 2500 (Illumina). Bowtie [56] was used to align the sequenced reads to the sgRNA library ...