Labshake search
Citations for Illumina :
701 - 750 of 9336 citations for Mouse Direct PCR Kit For Genotyping since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... (2022) (TruSeq DNA PCR-free libraries sequenced on Illumina NovaSeq6000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Purified PCR products were sequenced using HiSeq 2500 (Illumina). Bowtie [82] was used to align the sequenced reads to the sgRNA library ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse and forward amplicon PCR primers recommended by Illumina were used (16s Amplicon PCR Forward Primer= TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG ...
-
bioRxiv - Genetics 2023Quote: ... using PCR primers ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCAGAAGCAGCTCGACGC and GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCAGCTGCCGGAAGTGCT (Illumina adapters underlined) and Phire DNA polymerase (Thermofisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: Libraries were prepared using TruSeq DNA PCR-Free (Illumina) and were sequenced with 150-base-pair paired end reads on an Illumina HiSeq 4000 ...
-
bioRxiv - Cell Biology 2023Quote: ... purified transposed DNA was PCR amplified using Nextera (Illumina) i5 common adapter and unique i7 index adapters and NEBNext High Fidelity 2x PCR Master Mix for 5 cycles with the following program ...
-
bioRxiv - Plant Biology 2024Quote: ... The PCR-free TruSeq DNA (Illumina, San Diego, CA) was used to prepare a library ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were sequenced with a MiSeq (Illumina) using the reagent kit v3 (PE 2x300 ...
-
bioRxiv - Microbiology 2024Quote: ... which was determined by PCR and confirmed by Illumina whole-genome sequencing for this study.
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR-amplified cDNA was purified using AMPure XP beads and processed with the Nextera XT DNA Library Preparation Kits (Illumina, Cat. # FC-131-1024 and FC-131-1096) as per the protocol provided by the manufacturer.
-
bioRxiv - Cell Biology 2023Quote: ... qRT-PCR was conducted using AceQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) on an RT-PCR system (Illumina Eco, California, USA). The primers used are listed in Table 1 ...
-
bioRxiv - Genomics 2020Quote: ... and mouse libraries on a NextSeq 500 (Illumina).
-
bioRxiv - Genetics 2021Quote: ... DNA was PCR-amplified with TruSeq dual indexing primers (Illumina) to generate Illumina compatible libraries ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... followed by tailed-PCR using Nextera XT Index Primers (Illumina) (S1B Fig) ...
-
bioRxiv - Genomics 2019Quote: ... After a post-capture PCR (four amplification cycles using Illumina PE PCR 1.0 and PE PCR 2.0 primers ...
-
bioRxiv - Microbiology 2019Quote: ... qPCRs were performed in an Eco RT-PCR system (Illumina). Relative quantification of gene expression was determined by the 2−ΔΔCt method [25] applied with software conforming to minimum information for publication of RT-qPCR experiments (MIQE ...
-
bioRxiv - Microbiology 2021Quote: ... by 7 cycles PCR (16S Metagenomic Sequencing Library Preparation, Illumina). The amplicon libraries were purified using Agencourtusing the Agencourt AMPure XP system (Beckman) ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were then quantified and sequenced using MiSeq (Illumina).
-
Genomic bases of insularity and ecological divergence in barn owls (Tyto alba) of the Canary IslandsbioRxiv - Evolutionary Biology 2022Quote: ... and individually tagged 100bp TruSeq DNA PCR-free libraries (Illumina) were prepared according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... PCR amplification was performed in a 48 well plate (Illumina) on an Eco machine (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR amplicons were then sequenced on a NextSeq 500 (Illumina). Guide scores were calculated as median log2 fold change in the abundance between the initial and final population of that sgRNA similar to standard CRISPR screens ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary PCR was performed using Nextra XT index primers (Illumina). The secondary PCR condition was 95 °C (20 sec) ...
-
bioRxiv - Cell Biology 2019Quote: ... The PCR-amplified samples were sequenced on a HiSeq2500 (Illumina) at the Biomedical Sequencing Facility (CeMM/MUW).
-
bioRxiv - Cell Biology 2022Quote: ... PCR amplicons were purified and sequenced on a MiSeq (Illumina). Sequencing reads were mapped and the abundance of each sgRNA was measured ...
-
bioRxiv - Microbiology 2022Quote: ... Purified PCR products were then sequenced on a HiSeq400 (Illumina) with single end 100 bp reads at a minimum read depth of 5 million reads/sample.
-
bioRxiv - Cell Biology 2023Quote: ... Amplified and gel purified PCR products were sequenced by Illumina HiSeq (Azenta) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR-enriched and barcoded with unique dual indexes (Illumina, 20027213) using six PCR cycles ...
-
bioRxiv - Microbiology 2023Quote: ... followed by PCR amplification using TruSeq-designed primers from Illumina guidelines ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR products were sequenced on a HiSeq 4000 instrument (Illumina) at 50bp reads to a depth of 30M reads per sample.
-
bioRxiv - Neuroscience 2023Quote: ... Mouse GRCm38/mm10 genome annotation was accessed from Illumina’s iGenomes repository (available at https://support.illumina.com/sequencing/sequencing_software/igenome.html ...
-
bioRxiv - Microbiology 2020Quote: ... and TruSeq Index PCR Primer barcodes (Illumina, San Diego, CA, USA) were used to prepare and index each individual library ...
-
bioRxiv - Neuroscience 2022Quote: ... on the Eco Real-Time PCR System (Illumina, San Diego, CA). Cycling parameters were as follows ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR samples contained 11.2 μL of KAPA polymerase mix (Illumina), 4.4 μL each of the 5 μM column and row indexing primers ...
-
bioRxiv - Immunology 2021Quote: ... and indexed TruSeq Small RNA PCR primers (Illumina, San Diego, CA) as specified(Stoeckius et al. ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... following manufacturers instructions and TruSeq DNA PCR-Free Library (Illumina, USA) sequencing libraries were prepared after quality control ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were PCR-purified and sequenced on a HiSeq2500 machine (Illumina) generating 50 base pair (bp ...
-
Naked Mole-Rat Hematopoietic Stem and Progenitors are Highly Quiescent with an Inherent Myeloid BiasbioRxiv - Cell Biology 2021Quote: ... and indexed TruSeq Small RNA PCR primers (Illumina, San Diego, CA) as specified(13) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and prepared individually tagged 100bp “TruSeq DNA PCR-free” libraries (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplicons were gel purified and sequenced on a HiSeq4000 (Illumina) to obtain about 30 million reads for each samples ...
-
bioRxiv - Systems Biology 2021Quote: ... and libraries were amplified by PCR with barcoded Nextera primers (Illumina) using 2X NEBNext High-Fidelity PCR Master Mix (NEB) ...
-
bioRxiv - Cancer Biology 2022Quote: ... purified PCR products were amplified using indexed adapter primers from Illumina to generate barcoded amplicons and NEBNext Ultra II Q5 Master Mix (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... The variable sequence was PCR-amplified and sequenced (Illumina HiSeq 4000) to verify clone representation of all library component ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCRs were performed using index primers (NEBNext multiplex oligos for Illumina, set 1 ...
-
bioRxiv - Molecular Biology 2022Quote: Cell lysate was PCR amplified with genomic primers flanked by Illumina adaptor overhang to generate approximately 300 base products ...
-
bioRxiv - Molecular Biology 2023Quote: ... Library fragments were amplified using standard PCR and Nextera primers (Illumina) by adding 25 μl of 2x NEBnext master mix ...
-
bioRxiv - Microbiology 2023Quote: ... library tagmentation and 16-cycle PCR amplification using Nextera XT (Illumina), and 150 bp paired-end sequencing using an Illumina MiSeq or NextSeq.
-
bioRxiv - Molecular Biology 2023Quote: ... PCR products were sequenced on a HiSeq 2000 sequencing platform (Illumina). A fraction of the sgRNA plasmid library was also sequenced to determine the sgRNA distribution in the input material ...
-
bioRxiv - Biophysics 2022Quote: ... and amplicons were generated by PCR for amplicon sequencing by Illumina 2×300 paired-end sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplicons surrounding Usp18 sgRNA cut sites were sequenced (MiSeq, Illumina) and frame-shift mutation frequency for triploid CT26 cells was estimated to be ∼65% by the following equation ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 6-digit index primers (Illumina RNA PCR Index Primers RPI1-RPI28) were used instead of 10-digit index primers suggested by the LM-Seq protocol ...