Labshake search
Citations for Illumina :
151 - 200 of 621 citations for IL 5 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... DNA methylation levels were measured using Infinium Human Methylation 450 arrays (Illumina) according to the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2023Quote: ... TruSeq Stranded Total RNA with Ribo-Zero Human/Mouse/Rat kit (Illumina) was used to prepare RNA-seq libraries according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... RNase H or the Ribo-Zero method (human, mouse, plants) (Illumina, USA) was used to remove rRNA ...
-
bioRxiv - Genetics 2024Quote: ... or in the Human Imprintome array BeadChip (Illumina, Inc., San Diego, CA), amplified ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was analyzed using Infinium Human Methylation 450K BeadChip system (Illumina), as described [91] ...
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl Nextera i5 primer (S5xx, Illumina), and 5 μl of a custom i7 primer mix (0.5 μM i7_BCx + 10 μM i7_primer ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Genomics 2020Quote: ... The methylation array used an Infinium Human methylationEPIC BeadChip (Illumina, San Diego, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: RPF were depleted of ribosomal RNA with the Ribo-zero Human kit (Illumina) according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2019Quote: ... and rRNA-depletion (“Ribo-Zero”; Illumina Ribo-Zero Gold Kit (Human/Mouse/Rat), Cat # MRZG126 ...
-
bioRxiv - Genomics 2020Quote: ... and analysed using the Infinium Human Methylation 450K BeadChips (Illumina, San Diego, CA) according to the manufacturer’s protocol.
-
bioRxiv - Genomics 2019Quote: We downloaded DNA methylation data as beta values (platform Illumina Human Methylation 450) from GDC Data Portal (50 ...
-
bioRxiv - Genomics 2019Quote: ... in data obtained using Human Infinium Bead Arrays (Illumina’s HM450 or EPIC arrays), an established technology to detect DNA methylation 40 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Methylation was measured using the Infinium Human Methylation 450K BeadChip Array from Illumina. The extent of cytosine methylation was represented by a beta value ranging from 0 (fully unmethylated ...
-
bioRxiv - Genetics 2020Quote: ... or the TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat kit (Illumina) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... ribosomal RNA was removed using the Ribo-Zero Human/Mouse/Rat kit (Illumina). Sequencing libraries were generated according to the TruSeq stranded total RNA (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... SNP genotyping was performed with the HumaHap650Y_V3 or Human 1M-Duo_V3 BeadChips (Illumina) according to manufacturer’s instruction as previously described [48] ...
-
bioRxiv - Genomics 2023Quote: ... Methylation was assessed using the Infinium Human Methylation 450K Bead Chip (Illumina, Inc). A total of 865918 CpGs were present in the dataset ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Microbiology 2019Quote: ... which was denatured and run on the MiSeq sequencer at a final concentration of 5 pM alongside a 5 pM PhiX control (Illumina). Raw reads generated by MiSeq were error-corrected and filtered using DADA2 through QIIME2 (https://qiime2.org).38 Filtered reads were clustered de novo into Operational Taxonomic Units (OTUs ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2019Quote: ... low call rate (> 5% low quality data [Illumina detection P>1×10−6 ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Cancer Biology 2021Quote: ... and PCR and sequencing were performed as described previously (2 x 250bp paired-end reads, on an Illumina Miseq (Lemont, IL, USA)) [68–70] ...
-
bioRxiv - Molecular Biology 2020Quote: ... using Illumina whole-genome expression array Human HT-12 V4 (Illumina, Saffron Walden, U.K.). Normalization of the quantified signals (background corrected ...
-
bioRxiv - Developmental Biology 2019Quote: The (Illumina, San Diego, CA gene expression arrays (Illumina Human HT-12 Expression BeadChip) and Infinium 450K CpG methylation raw array data analyzed in these studies were published previously and available at Gene Expression Omnibus under accession numbers GSE65211 and GSE65214 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Each library was sequenced to 2x human genome coverage on Novaseq sequencer (Illumina, CA).
-
bioRxiv - Cell Biology 2020Quote: ... then rRNA-depleted using Ribo-Zero rRNA Removal kit for human samples (Illumina MRZH11124) before proceeding with library preparation (TruSeq mRNA Stranded Library preparation kit ...
-
bioRxiv - Cell Biology 2022Quote: ... Ribosomal RNA was removed by Illumina Ribo-Zero Gold rRNA Removal Kit Human/Mouse/Rat (Illumina, San Diego, CA, USA) and stranded total RNA-seq libraries were prepared using the Illumina TruSeq RNA Sample Preparation v2 Kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... All RNA samples were treated with RiboZero (Human/Mouse/Rat) (Illumina, San Diego, CA) for the depletion of ribosomal RNA ...
-
bioRxiv - Genetics 2020Quote: RNA-seq libraries (TruSeq® Stranded Total RNA Library Prep Human/Mouse/Rat, Illumina) were prepared from 150 ng of previously isolated viral RNA according to the manufacturers’ protocol ...
-
bioRxiv - Systems Biology 2019Quote: RNA-Seq of human individual tissues and mixture of 16 tissues (Illumina Body Map),
-
bioRxiv - Cancer Biology 2022Quote: ... The reference genome sequences for human (hg38) and mouse (mm10) were downloaded from Illumina iGenomes (www.support.illumina.com/sequencing/sequencing_software/igenome.html) ...
-
bioRxiv - Genetics 2022Quote: ... in adolescents and Illumina Human-6 Expression Bead Chips (Illumina, Inc. San Diego, CA) in adults ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA-depleted by a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina), and reverse transcribed by ProtoScript II Reverse Transcriptase (New England Biolabs) ...
-
bioRxiv - Immunology 2024Quote: ... The Ribo-Zero Gold (Human/Mouse/Rat) and (Yeast) kit (Illumina, San Diego, CA) were used to deplete rRNA using 300 ng total RNA as input ...
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...