Labshake search
Citations for Illumina :
351 - 400 of 621 citations for IL 5 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μg chromatin-associated RNAs were depleted of ribosomal RNA depletion using Ribo-Zero Magnetic Gold Kit (human/mouse/rat; Illumina), according to the manufacturer’s instruction ...
-
bioRxiv - Genomics 2021Quote: ... rRNA was removed and total RNA library was prepared with TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat (Illumina) and sequenced by Illumina platform HiSeq2500 Paired-end 125 bp.
-
bioRxiv - Immunology 2021Quote: ... Sequencing was performed in the Human Immunology Core Facility at the University of Pennsylvania using an Illumina 2× 300-bp paired-end kit (Illumina MiSeq Reagent Kit v3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... rRNA was depleted using Ribo-Zero™ Magnetic Gold Kit for rRNA depletion (Human/Mouse/Rat) (Epicentre for Illumina #MRZG12324) according to manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2020Quote: ... ribosomal RNA (rRNA) was depleted from the total RNA extracts using the Ribo-Zero Gold (human-mouse-rat) kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... rRNA was removed using Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat) and Ribo-Zero rRNA Removal Kit (Bacteria) (Illumina). In order to reduce the impact of the host transcriptome on subsequent analysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sequencing libraries were generated using the TruSeq Stranded Total RNA with Ribo-Zero Human/ Mouse/Rat Low-throughput (LT) kit (Illumina) and run on a NextSeq 500 for paired-end sequencing using the NextSeq 500/550 High Output v2 Kit ...
-
bioRxiv - Cell Biology 2021Quote: ... pooled and sequenced 75 bp paired-ended (human samples) or single-end (cultured and sorted fibroblasts) on the NextSeq 500 (Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... Both samples (footprints and total mRNA) went through a ribosomal RNA removal step using the Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina). The footprint samples were then purified on a 15% TBE-Urea polyacrylamide gel (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: All 450K array methylation level files were downloaded (Data Type: “Methylation beta value”, Platform: “Illumina Human Methylation 450”; n = 507). The average CpG methylation level over DMRs identified in this study and GENCODE transcript promoters was calculated in all TCGA LUAD and matched normal samples ...
-
bioRxiv - Physiology 2022Quote: ... one microgram of total RNA was used to construct cDNA libraries with the TruSeq Stranded Total RNA with Ribo-Zero Gold Human/Mouse/Rat kit (Illumina). Sequencing was performed using Illumina NovaSeq 6000 (coverage - 50 x ...
-
bioRxiv - Molecular Biology 2022Quote: ... rRNA was depleted from total RNA using the Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat) (Illumina, San Diego, CA) to enrich for coding RNA and long non-coding RNA ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA libraries were prepared using the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human/Mouse/Rat Kit (REF. RS-122-2201/2202, Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Ribosomal RNA was depleted using the RiboZero rRNA Removal Kits for Gram-positive bacteria and/or for human/mouse/rat (Illumina). 300 bp-insert RNA-seq Illumina libraries were constructed using ∼1.0 μg of enriched mRNA that was fragmented then used for synthesis of strand-specific cDNA using the NEBnext Ultra Directional RNA Library Prep Kit (NEB-E7420L) ...
-
bioRxiv - Genomics 2023Quote: ... 1 µg RNA was converted to ribosomal depleted cDNA libraries ready for sequencing using the TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... rRNA was depleted from total RNA using the Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat) (Illumina, San Diego, CA) to enrich for coding RNA and long non-coding RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was extracted with a Direct-zol RNA MicroPrep Kit and subjected to an RNA-Seq library preparation using a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) followed by a TruSeq Stranded Total RNA Kit (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... workflow was used to estimate a matrix of sample gene expression values (92–94) using the reference human genome (GRCh37; Ensembl release 75) obtained from Illumina’s iGenomes resource (https://support.illumina.com/sequencing/sequencing_software/igenome.html) ...
-
bioRxiv - Cancer Biology 2023Quote: A minimum of 500 ng of high-quality DNA from 100 EwS FFPE samples was used for methylation and CNV analysis with the Infinium Human Methylation 450K BeadChip (EPIC array; Illumina). This method can analyze 864,928 CpGs including main CpG islands and CpG sites outside of CpG islands ...
-
bioRxiv - Microbiology 2024Quote: ... total RNA from mouse gut or human donors was subjected to ribosomal RNA depletion by Ribo-Zero Plus Microbiome rRNA Depletion Kit (Illumina) and cDNA libraries were generated by using Illumina Stranded Total RNA Prep (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was extracted with a Direct-zol RNA MicroPrep Kit and subjected to RNA-Seq library preparation using a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) followed by a TruSeq Stranded Total RNA Kit (Illumina).
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µg of total cellular RNA was depleted of ribosomal RNA (RiboZero kit, Illumina), and subjected to base hydrolysis ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1.25 µL each of i5 and i7 indexing primers (Illumina, diluted 1:5). The samples were indexed with the following PCR cycles ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Diluted libraries were spiked with 5% Phi-X control (Illumina, San Diego, CA, USA) and sequenced using the Illumina MiSeq (Illumina Inc. ...
-
bioRxiv - Molecular Biology 2022Quote: ATAC-seq was conducted on 5×104 live cells using Nextera Tn5 transposase (Illumina) as previously described (Buenrostro et al. ...
-
bioRxiv - Immunology 2022Quote: ... 5’ expression library was sequenced with NovaSeq 6000 S1 (100 cycles) (Illumina, cat. 20012865) and the V(D)J library was sequenced with NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 U of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 μl and incubated at 25°C for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 units of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 µl and incubated at 25°C for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 µL of the Illumina PCR Primer Cocktail (PPC, Illumina FC-121-1030). PCR conditions were as follows ...
-
bioRxiv - Genetics 2020Quote: ... Pooled and denatured library (8 pM) containing 5% volume of PhiX (control library; Illumina) was sequenced using the Illumina MiSeq system with MiSeq Reagent Kit V3 (300-bp paired-end reads ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Primer Cocktail (Nextera DNA Sample Preparation Kit and Nextera Index Kit, Illumina). Amplification was performed in a Veriti 96 Well Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Genomics 2021Quote: ... then 4 pM of the pooled library with 5% PhiX v3 control (Illumina, USA) was loaded onto an Illumina MiSeq instrument and sequenced using MiSeq V3 chemistry ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library amplification was performed using 5 μL Nextera XT i7 forward index primer (Illumina) and 5 μL custom i5 index primers (2 μM ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Genomics 2020Quote: ... CNV analysis was performed on a combined cohort of 130 sequenced hESC lines and a control cohort consisting of 243 human samples from primary blood or lymphoblastoid cell lines (LCL) that had undergone WGS on the same platform (Illumina HiSeqX) and to similar depth as the hESC lines (Pato et al. ...
-
bioRxiv - Molecular Biology 2021Quote: Libraries from human liver tissue and wild type FL83B cells were prepared with TruSeq Stranded Total RNA Library Prep Gold (Illumina, #20020599), single-read sequencing was performed using the NextSeq 500 (Illumina) ...
-
bioRxiv - Cancer Biology 2020Quote: ... We used summarized log-scale intensities representing copy number profiles generated by combining probe intensities from four platforms (Agilent Human Genome CGH Microarray 44A, Nimblegen HG19 CGH 385K WG Tiling v2.0, Affymetrix GeneChip Human Mapping 500k Array Set and Illumina Human1Mv1_C BeadChip). A threshold of ≥ 0.9 and ≤ -0.9 was used to call copy number gains and losses ...
-
bioRxiv - Molecular Biology 2020Quote: Ribosomal RNA was depleted from the total RNA using the Ribo-Zero Gold rRNA removal kit (Human/Mouse/Rat) (Illumina, USA). The ribo-depleted RNA was used to create an ssRNA-Seq library ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA-Seq libraries were prepared using TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human (RS-122-2201, Illumina Inc.) following manufacturer’s protocol ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... The bisulfite-converted DNA samples were then processed for hybridization and staining using either the Illumina Infinium Human Methylation 450 BeadChip Kit or the Illumina Infinium MethylationEPIC BeadChip Kit (Illumina Inc.) according to the manufacturer’s recommendations ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... The resulting cRNA samples were hybridized to an Illumina Human WG6 Expression BeadChip array for 14-20 hour at 58°C in an Illumina Hybridization Oven (Illumina Inc.). Arrays were washed and scanned following the protocols in the Illumina Whole-Genome Gene Expression Direct Hybridization Assay Guide (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The resulting FASTQ files were aligned to the human reference genome (build GRChg38) and transcript abundance was quantified using salmon (Illumina DRAGEN). The DESeq2 package was used to identify differentially expressed transcripts between the H3.3E50K and wildtype H3.3 expressing HMECDD cells ...
-
bioRxiv - Immunology 2021Quote: ... DRB3/4/5 kits) for sample library preparations and ran on a Miseq sequencer (Illumina), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2021Quote: ... with the libraries clustered at 12-15pM and mixed with 5% PhiX genomic DNA (Illumina).
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were diluted and mixed with 5-20% phiX control v3 (Illumina FC-110-3001) and sequenced with oSK326 for read 1 and oSK324 for the index read.
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5-day deligated samples were sequenced (the ligated sample was sequenced on the Illumina Nextseq500 and all others were sequenced on the Illumina Nextseq2000) ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...