Labshake search
Citations for Illumina :
51 - 100 of 621 citations for IL 5 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... purified and sequenced on a single lane on an Illumina Hi-Seq 2500 (Illumina Inc, USA) with single-end 100 bp reads ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Hi-C libraries were sequenced on a NextSeq 550 sequencer (2×75 bp, paired-end Illumina NextSeq with the first ten bases acting as barcodes50).
-
bioRxiv - Genomics 2020Quote: Hi-C data were obtained in the form of unprocessed fastq files (paired-end Illumina reads) for IMR90 cells from the NCBI Gene Expression Omnibus (GEO)-accession GSE43070[12] ...
-
bioRxiv - Genomics 2024Quote: ... The production-scale sequencing of the Hi-C library was performed on a NextSeq2000 sequencer (Illumina) using 150 bp paired-end read mode at the Berlin Center for Genomics in Biodiversity Research.
-
bioRxiv - Microbiology 2024Quote: ... Hi-SC2 libraries were prepared and subjected to pair-end sequencing on a NextSeq 500 (Illumina). After sequencing ...
-
bioRxiv - Genomics 2021Quote: ... platform = c(”Illumina Human Methylation 450”), and sample.type = c(”Primary solid Tumor”,”Solid Tissue Normal”) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Paired-end 2 x 75 bp NSQ 500/550 Hi Output KT v2.5 −75 CYS (Illumina, 20024906) was performed for RNA-seq libraries on an Illumina Nextseq 500 instrument ...
-
bioRxiv - Genomics 2021Quote: ... and (3) 134 Gb (~100× depth) chromosome conformation capture sequencing (Hi-C) data (sequenced by Illumina platform).
-
bioRxiv - Genomics 2022Quote: ... Hi-C libraries were sequenced on a NextSeq 550 apparatus (2 × 75 bp, paired-end Illumina NextSeq). Contact maps were generated from reads using the hicstuff pipeline for processing generic 3C data ...
-
bioRxiv - Neuroscience 2019Quote: ... Paired-end 100 bp sequencing reads were obtained using Illumina Hi-seq 2500 (Illumina, San Diego, CA).
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were sequenced on the Illumina Hi-Seq 2500 Next-Generation-Sequencer (Illumina, San Diego, CA, USA) using 50bp single-end sequencing.
-
bioRxiv - Genomics 2022Quote: ... and DpnII and HindIII Hi-C material was sequenced (2×50 nt) on a HiSeq 4000 (Illumina) following the manufacturer’s instructions) ...
-
bioRxiv - Genomics 2022Quote: ... Chromosome-scale scaffolding was then performed by HiRise44 with Hi-C reads obtained from HiSeq 2500 (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... followed by sequencing with an Illumina HiSeq 2500 (Illumina, San Diego, IL, USA) to construct a library.
-
bioRxiv - Genomics 2021Quote: ... four human CNV membranes and four human RPE-choroidal control tissues) were sequenced on the NextSeq 500 (Illumina) with 1 × 75 bp ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing of the Hi-C library was conducted on an Illumina HiSeq 2500 (Illumina, San Diego, CA, USA) with 101 bp paired-end reads ...
-
bioRxiv - Genomics 2020Quote: ... Uniquely barcoded libraries from single-cells pooled together and sequenced using a HiSeq-Hi-output-2500 sequencer (Illumina). In total ...
-
bioRxiv - Genomics 2022Quote: ... we further sequenced the same libraries on a single lane of rapid flowcell in Hi-seq 2500 (Illumina) at Otago Genomics Facility (OGF) ...
-
bioRxiv - Genomics 2021Quote: BD Infinium Human Methylation 450 arrays (Illumina) were retrieved from the European Genome-phenome Archive (EGA ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human Ribo-Zero rRNA depletion kit (Illumina). Paired-end 150+150 bp sequencing was done with Illumina NextSeq 500 using NextSeq 500/550 High Output Kit v2.5 for HeLa samples and with Illumina NovaSeq 6000 using partial S4 flow cell lane for patient samples.
-
bioRxiv - Neuroscience 2022Quote: ... A Human OmniExpress v1.2 BeadChip array (Illumina) was used post-editing to check for any gross karyotype abnormalities ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human Ribo-Zero rRNA depletion kit (Illumina). Paired-end 150+150 bp sequencing was performed at the Institute for Molecular Medicine Finland FIMM Genomics unit with Illumina NovaSeq 6000 using partial S4 flow cell lane ...
-
bioRxiv - Neuroscience 2020Quote: ... before single-end sequencing to generate 50 bp reads on the Hi-Seq 4000 platform (Illumina, San Diego, USA).
-
bioRxiv - Genetics 2020Quote: ... The libraries were pooled and loaded at a concentration of 1.8pM with 10% PhiX spike-in for sequencing on an Illumina NextSeq 550 System using Illumina NextSeq 150 Cycle Hi-Output v2.5 kits (Illumina) to achieve a targeted read depth of ∼33,000 reads per nucleus ...
-
bioRxiv - Plant Biology 2023Quote: ... The 5μg total RNA (DNase-treated) was outsourced for the RNA-Seq on Hi-Seq 2000 genome analyzer (Illumina) sequencing platform ...
-
bioRxiv - Genomics 2023Quote: ... about 40 ng purified pre-amplified Hi-C sample was fragmented in two 50 μl tagmentation mix (1x TD buffer and 0.5 μl TDE1 (Illumina Tagment DNA TDE1 Enzyme and Buffer Kit ...
-
bioRxiv - Genomics 2023Quote: ... and sequenced by PacBio Sequel II. Hi-C libraries were prepared following a standard protocol (Belton et al. 2012) and sequenced by Illumina HiSeq 4000 (Illumina ...
-
bioRxiv - Cancer Biology 2019Quote: DNA methylation data (Illumina human methylation 450k BeadChip) and clinical information of 8,118 patients across 24 tissue types were obtained from in GDC data portal [29] using TCGAbiolink (Bioconductor package ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350 ...
-
bioRxiv - Microbiology 2023Quote: ... ‘human/mouse’ and ‘bacteria’ Ribo-Zero kits (Illumina). RNA quality and concentration were verified by BioAnalyzer (Agilent Technologies ...
-
bioRxiv - Genetics 2024Quote: The Infinium Human Methylation EPIC BeadChip (Illumina, USA) array was performed according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Methylation data (Illumina Human Methylation 450 platform) for TCGA cohorts were downloaded from the Firebrowse website hosed by Broad Institute of MIT and Harvard ...
-
bioRxiv - Molecular Biology 2021Quote: ... Paired-end Illumina sequencing libraries were prepared and total RNA-seq was performed with the Hi-seq 2500 (Illumina Inc.).
-
bioRxiv - Genomics 2019Quote: The statistical package edgeR (Version 3.7) within the R software suite (Version 3.1) was used to analyse the RNA-seq (Illumina Hi-Seq) data and to identify transcripts significantly differentially expressed between P ...
-
bioRxiv - Microbiology 2020Quote: A NextSeq run was completed on the pooled libraries using the NextSeq 500 hi-output v2 75-cycle kit and Buffer Cartridge (Illumina). Sequence files were downloaded from the MIP NGS server ...
-
bioRxiv - Microbiology 2021Quote: ... A NextSeq run was completed on the pooled libraries using the NextSeq 500 hi-output v2 75-cycle kit and Buffer Cartridge (Illumina). Sequence files were downloaded from the NGS server ...
-
bioRxiv - Plant Biology 2021Quote: ... Libraries were constructed using the Nextera DNA preparation kit and sequenced on an Illumina Hi-Seq 2500 platform (paired-end 125 bp reads) (Illumina). Quality control reports for the raw sequencing reads were generated using FastQC (Andrews ...
-
bioRxiv - Microbiology 2019Quote: ... Libraries for all samples were sequenced as 150 bp paired-end reads on a single lane of Illumina Hi-Seq 4000 (Illumina). Reads were bioinformatically de-multiplexed ...
-
bioRxiv - Neuroscience 2021Quote: ... Pooled sequencing libraries were loaded at a concentration of 1.8pM with 10% PhiX spike-in and sequenced using eight Illumina NextSeq 150 Cycle Hi-Output v2.5 kits (Illumina #20024907) on an Illumina NextSeq 550 System ...
-
bioRxiv - Neuroscience 2021Quote: Sequencing of the pooled libraries was completed by the NIDDK Genomics Core on an Illumina NextSeq 550 system using a NextSeq 150 Cycle Hi-Output v2.5 kit (Illumina #20024907), generating a total of 400 million reads for an estimated sequencing depth of 40,000 reads per cell ...
-
bioRxiv - Genomics 2019Quote: ... Two 3rd instar larvae were selected for Hi-C library construction and then sequenced on a HiSeq 2500 platform (Illumina). In addition ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The Hi-C libraries were processed to paired-end sequencing on the Illumina Hiseq 4000 (Illumina, San Diego, CA, USA) platform with read length of 150 bp.
-
bioRxiv - Genetics 2022Quote: ... Variants considered causative were validated in the proband and studied in his parents by deep amplicon sequencing performed using Nextera XT Kit (Illumina) and paired-end sequencing as described above for WES.
-
bioRxiv - Genetics 2023Quote: ... Samples were indexed and pairs for each experiment were pooled for sequencing using the NextSeq 500/550 Hi Output KT v2.5 (Illumina #20024907) on an Illumina NextSeq550 ...
-
bioRxiv - Genomics 2024Quote: The chromatin conformation capture (Hi-C) fragment libraries were constructed from 300-700 bp insert size and were measured by Illumina platform for auxiliary assembly (Rao et al. ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Genomics 2020Quote: ... Human libraries were sequenced on a NovaSeq 6000 (Illumina) and mouse libraries on a NextSeq 500 (Illumina).