Labshake search
Citations for Illumina :
201 - 250 of 2140 citations for 8 Benzyloxy 5 R 2 bromo 1 hydroxyethyl 1H quinolinone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Samples were sequenced on an Illumina Novaseq 6000 S4 flowcell (67 bp read 1 and 140 bp read 2) (Illumina, USA) to a depth of approximately 100,000 reads per cell ...
-
bioRxiv - Immunology 2021Quote: ... whose lengths were about 600 base pairs were sequenced using an Illumina Novaseq 6000 S4 flowcell (67 bp read 1 and 140 bp read 2) (Illumina, USA). Only read2 contained the sequence regarding the definition of T cell clones.
-
bioRxiv - Molecular Biology 2022Quote: ... Library preparation of high-quality RNA (RIN >8) was performed using the TruSeq RNA sample preparation kit (Illumina). Raw sequencing data was aligned to human genome B38 ...
-
bioRxiv - Developmental Biology 2019Quote: ... with RIN values > 8 were subjected to Automated TruSeq stranded total RNA with RiboZero Gold library preparation (Illumina). Single-end 50 bp reads were generated with HiSeq2500 ...
-
bioRxiv - Genomics 2020Quote: ... Genome-wide genotyping of 200 ng genomic DNA from the remaining 207 patients was carried out using Infinium HumanOmni2.5-8 v1.2 BeadChip microarrays (Illumina). After completion of the assay ...
-
bioRxiv - Microbiology 2019Quote: ... and 2×300bp PE Miseq (Illumina) sequencing at UBC Pharmaceutical Sciences Sequencing Centre (Vancouver ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 × 150 bp flow cells (Illumina).
-
bioRxiv - Synthetic Biology 2023Quote: ... 2% PhiX (PhiX Control v3, Illumina) was spiked into the sample and 20 µL were added to an Illumina iSeq 100 i1 Reagent v2 cartridge ...
-
bioRxiv - Neuroscience 2023Quote: ... and sequencing (Illumina HiSeq 2 × 150bp) were all performed at GeneWiz ...
-
bioRxiv - Biochemistry 2024Quote: ... Round 2 primers (Illumina TruSeq Adapters) were added to each reaction to 400 nM ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2×150 cycle strategy (Illumina Inc.). Paired-end reads were produced with a 100x coverage ...
-
bioRxiv - Genomics 2020Quote: ... Log R Ratio and B Allele Frequency were extracted using Genome Studio 2.0 (Illumina, San Diego, California, USA). Data available upon request.
-
bioRxiv - Cell Biology 2023Quote: ... Library preparation from RNA is performed with amplification (TruSeq Stranded Total RNA H/M/R-Gold, ILLUMINA®), either through automation (MICROLAB Star® ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Microbiology 2019Quote: ... which was denatured and run on the MiSeq sequencer at a final concentration of 5 pM alongside a 5 pM PhiX control (Illumina). Raw reads generated by MiSeq were error-corrected and filtered using DADA2 through QIIME2 (https://qiime2.org).38 Filtered reads were clustered de novo into Operational Taxonomic Units (OTUs ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Genomics 2023Quote: ... The resulting sequencing libraries were sequenced using the MiSeq system (Illumina v.2 kit, 2 × 150 bp).
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2019Quote: ... low call rate (> 5% low quality data [Illumina detection P>1×10−6 ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Developmental Biology 2022Quote: Transposed DNA fragments were purified using the Qiagen MinElute kit and amplified 6-8 cycles using the Nextera (Illumina) PCR primers ...
-
bioRxiv - Systems Biology 2021Quote: ... Libraries of extracted RNAs whose A260/A280 >1.8 and RIN >8 were built using the Illumina TruSeqTM RNA sample preparation kit (RS-122-2001, Illumina) and sequenced by an illumina HiSeq 2000 system with paired-end 100-bp reads ...
-
bioRxiv - Cell Biology 2019Quote: ... 100 to 200ng of high-quality total RNA sample (RIN >8) was processed using TruSeq Stranded mRNA kit (Illumina) according to manufacturer instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 8 µL was amplified and hybridized on the Infinium MehtylationEPIC BeadChip (EPIC array; Illumina, Inc., San Diego, CA, U.S.A.). All samples were randomized in a balanced manner for sex and Braak stage ...
-
bioRxiv - Genomics 2023Quote: ... 8 μl of modified DNA was subjected to methylation analysis on the Illumina Infinium MethylationEPIC BeadChip (Illumina, CA, USA) at UCL Genomics according to the manufacturer’s standard protocol.
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 12 µl of extracted RNA was depleted of rRNA using Ribo-Zero Gold H/M/R (Illumina) and then reverse-transcribed using random hexamers and SuperScript IV (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Log R Ratio (LRR) data was extracted for all probes and array annotation obtained from Illumina (InfiniumOmniExpress-24v1-3_A1). LRR data was then smoothed and segmentation called using the CBS algorithm from the DNACopy54 ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA-seq libraries were prepared starting from 1µg of RNA using the TruSeq Stranded Total RNA Ribo-Zero H/M/R Gold kit (Illumina). Libraries were quantified in a Qubit system (ThermoFisher ...
-
bioRxiv - Neuroscience 2022Quote: ... B allele frequency and log R ratio of each single nucleotide polymorphism (SNP) marker were collected from GenomeStudio (Illumina) and analyzed with PennCNV [70] and QuantiSNP [10] with default parameter settings ...
-
bioRxiv - Developmental Biology 2021Quote: ... according to the manufacturer’s reference guide (document #15066016 v01) with Ribo-Zero Gold Kit (H/M/R) (Illumina, MRZG126). The prepared libraries were sequenced on a HiSeq 2500 system (Illumina).
-
bioRxiv - Neuroscience 2019Quote: ... using 2 × 75bp paired-end reads and 2 × 8bp index reads with a 200 cycle kit (Illumina, 20012861). Samples were sequenced at an average of 1.5M reads per cell.
-
bioRxiv - Neuroscience 2019Quote: ... using 2 × 75bp paired-end reads and 2 × 8bp index reads with a 200 cycle kit (Illumina, 20012861). Samples were sequenced at an average of 1.5M reads per cell.
-
bioRxiv - Systems Biology 2021Quote: ... S4 reagent cartridge (2×100 bp) (Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... ADNI GO/2 participants (Illumina HumanOmniExpress BeadChip), and ADNI3 participants (Illumina Omni 2.5M ...
-
bioRxiv - Microbiology 2020Quote: ... and sequencing (2 × 150 bp, Illumina HiSeq) were performed by Genewiz (South Plainfield ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Illumina, catalog No. MS-102-2003) by the University of Michigan Microbial Systems Molecular Biology Laboratory as described previously (14) ...
-
bioRxiv - Microbiology 2021Quote: ... 2) merged triplicates for DC3000 + (Illumina only), 3 ...
-
bioRxiv - Microbiology 2022Quote: ... generating 2 × 300bp paired-end reads (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... and sequenced on 2×150 Miseq (Illumina). Clonal abundances were estimated using a pipeline adapted from 110 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or SMART-Seq™ 2 (Illumina, 20040532), followed by NovaSeq (RIP-seq experiments from Figs ...
-
bioRxiv - Immunology 2023Quote: ... and HiSeq2500 V2 2×150bp (Illumina®) protocols at the “Institut du Cerveau” (ICM ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2.5 µl of each Nextera Index 1 (N7XX) and Nextera Index 2 (N5XX) primers from a Nextera DNA Sample Preparation Index Kit (Illumina, FC-121-1011). PCR was performed according to the following protocol ...
-
bioRxiv - Genetics 2021Quote: ... Individual sequencing barcodes were added to each sample by amplifying the entire 40 μL elution in a 100 μL Q5 NEBNext reaction with 0.5 μM of TruSeq_Universal_Adapter primer and a reverse primer containing a unique 8 bp index (Illumina_Multiplex, Supplementary Table 14) for sample demultiplexing post-sequencing ...
-
bioRxiv - Genomics 2020Quote: ... Multiple mate-paired libraries (3, 8, 12 and 16 kb) were also constructed using the Nextera Mate-Paired Library Construction kit (Illumina). Libraries were sequenced on the Illumina HiSeq 2500 sequencer using the Illumina TruSeq PE Cluster kit v3 and TruSeq SBS kit v3 (101 ...