Labshake search
Citations for Illumina :
51 - 100 of 2140 citations for 8 Benzyloxy 5 R 2 bromo 1 hydroxyethyl 1H quinolinone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... The libraries were amplified for 5 cycles and sequenced in 2×75-bp paired-end mode with NextSeq 500 sequencing technology (Illumina), per the manufacturer’s recommendations.
-
bioRxiv - Genomics 2024Quote: ... A 2.5-kb ‘jumping’ library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced on an Illumina HiSeq 2000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... with MiSeq Reagent Kit V3 (150 cycle) (Illumina, MS-1-2-3001). The sequencing data was de-multiplexed and trimmed to contain only the sgRNA sequence cassettes ...
-
bioRxiv - Microbiology 2020Quote: ... then further diluted to 8 pM in HT1 buffer (Illumina) and were sequenced using an Illumina MiSeq V2 500 cycle kit cassette with 16S rRNA library sequencing primers set for 250 base pair ...
-
bioRxiv - Genomics 2019Quote: ... 500bp and 800bp) and long insert mate-pair reads (4-6Kb, 8-10Kb and 1-20Kb) were sequenced using HiSeq 2500 (Illumina Inc., USA) at SciGenom Labs ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1.25 µL each of i5 and i7 indexing primers (Illumina, diluted 1:5). The samples were indexed with the following PCR cycles ...
-
bioRxiv - Genomics 2023Quote: ... All libraries were pooled and subjected to paired-end 75 bp sequencing (paired- end 76 nt reads with the first 1 nt of Read 1 and the last 1 nt of Read 2 trimmed) using the NextSeq500 system (Illumina, CA, USA). For each library ...
-
bioRxiv - Genomics 2020Quote: ... We used Ribo-Zero Magnetic Kit H/M/R (Illumina) to remove rRNAs from total RNA samples for analyses of non-polyadenylated RNAs.
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared with Illumina DNA prep (Illumina(R), San Diego ...
-
bioRxiv - Genomics 2021Quote: ... Each batch was sequenced separately on 1-flowcell (2 lanes) HiSeq 2500 (Illumina) Rapid Mode platform with a single-end (1×50 bp ...
-
bioRxiv - Microbiology 2020Quote: ... Read 1 and 2 adapter recognition sequences were provided for adapter removal (Illumina TruSeq Adapter Read 1 ...
-
bioRxiv - Microbiology 2023Quote: ... gRNA abundances (read 1) and UMI barcodes (read 2) were quantified by Illumina sequencing and subsequently processed by the analysis described below.
-
bioRxiv - Microbiology 2023Quote: ... The quantified and denatured libraries were sequenced using paired-end 2×250-bp chemistry with 5% PhiX as an internal control on the Illumina MiSeq 2000 platform (Illumina Inc., USA). The quality-filtered reads were de-novo assembled using SPAdes (version 3.11.1) ...
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...
-
bioRxiv - Bioengineering 2019Quote: ... provided by the Nextera® (R) XT Index Kit (Illumina, USA). Finally ...
-
bioRxiv - Cell Biology 2021Quote: ... using NextSeq 500 (2×75 bp) and HiSeq 4000 (1×50 bp) equipment (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... 2 × 1 μl (concentration of 10pmol/μl) MiSeq Nextera XT adapters (dual indexed, Illumina), and 6.5 μl of mQ water (Ultrapure) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... one RNA pool of 5 livers from each treatment and sex were independently subjected to sequencing (Illumina Novaseq 6000 paired-end (2×150)) ...
-
bioRxiv - Genomics 2022Quote: ... and DRB3, 4, 5 (exon 2) genes with Fluidigm Access Array (Fluidigm, Singapore) and sequenced on an Illumina MiSeq sequencer (Illumina, San Diego, USA). HLA alleles and genotypes are called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Microbiology 2020Quote: ... Read 1 and 2 adapter recognition sequences were provided for adapter removal (Illumina TruSeq Adapter Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCT TG, Illumina TruSeq Adapter Read 2 ...
-
bioRxiv - Neuroscience 2022Quote: ... using single end 75bp for Read 1 and 8bp for index 1 and 8bp for Index 2 with a high output 75bp kit (20024906, Illumina).
-
bioRxiv - Microbiology 2021Quote: ... The 8 pM library containing 15% PhiX control v3 (Illumina Canada, Canada) was sequenced on a MiSeq instrument (Illumina Inc ...
-
bioRxiv - Immunology 2020Quote: ... cell nuclei were isolated and transposed with 8 μL Tn5 (Illumina Nextera) at 37°C for 60 minutes ...
-
bioRxiv - Bioengineering 2023Quote: Total RNA samples (RIN > 8) were sequenced on HiSeq 1500 (Illumina Inc.) using HiSeqV2 Rapid chemistry according manufacturer’s instructions in Monash Health Translation Precinct RNA-Seq facility ...
-
bioRxiv - Cell Biology 2022Quote: ... a PCR enrichment step was performed (8 cycles) using unique primer pairs for each library (NEBNext Multiplex Oligos for Illumina-Dual Index Primers Set 1).
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina) were used for construction of complementary DNA libraries and the complementary DNA libraries were sequenced on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 (Illumina) and the HiSeq Rapid SBS Kit v2-HS (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 (Illumina) for the sequencing.
-
bioRxiv - Immunology 2023Quote: ... 2 (Illumina) was the primer source ...
-
bioRxiv - Genomics 2021Quote: ... and four mate-pair sequencing libraries (insert sizes of 2, 5, 10, and 15 kb) in accordance with manufacturer protocols (Illumina, San Diego, CA, USA). Libraries were then sequenced using a HiSeq2000 instrument (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... and diluted to 5 pM prior to sequencing on an Illumina MiSeq platform with a 2 × 250 bp paired-end protocol (Illumina, San Diego, CA, USA). Sequencing reads were deposited in the European Nucleotide Archive (ENA ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1–2 mg of total RNA was used for Ribo-Zero rRNA Removal kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5 μl of Nextera XT index primers 1 and 2 (Nextera XT Index kit, Illumina) and 2.5 μl of templated DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA fragments were then amplified by PCR using Nextera index primer 1 and 2 (Illumina) and produced by PCR amplification (10–13 cycles ...
-
bioRxiv - Microbiology 2019Quote: ... 2x 8 nt dual indexed adapters from TruSeq RNA CD index kit (Illumina) were added to the libraries for multiplexing ...
-
bioRxiv - Systems Biology 2023Quote: ... and biotinylated as described 8 using HumanHT-12 v4 Expression BeadChips (Illumina, Inc.). Gene expression data were extracted and log2-transformed using GenomeStudio software (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... 8 µL of i7 primer (NEBNext Multiplex Oligos for Illumina (Dual Index primers); NEB #E7600S ...
-
bioRxiv - Genomics 2022Quote: ... We partitioned the genes into three categories: (1) >5-fold higher in Illumina (“Higher count in Illumina”); (2 ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Neuroscience 2020Quote: ... Libraries generated with indexing version 2 (Supplementary Table 1) were sequenced on a HiSeq4000 (RRID:SCR_016386, Illumina) using custom sequencing primers with following read lengths ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Cell Biology 2022Quote: ... an R package designed for statistical analysis of gene counts generated from Illumina-based sequencing ...
-
bioRxiv - Neuroscience 2022Quote: ... The B-allele frequency and Log R ratio values were downloaded from Illumina GenomeStudio and processed and plotted using the GWASTools package in R (v3.6.1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Microbiology 2019Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...
-
bioRxiv - Microbiology 2021Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...