Labshake search
Citations for Illumina :
401 - 450 of 9161 citations for RT PCR kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: Sequencing libraries were prepared from 1 ng of each VSG PCR product using the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096) following the manufacturer’s protocol except for the final cleanup step ...
-
bioRxiv - Neuroscience 2022Quote: ... at the HIHG or The American Genome Center at Uniformed Services University of the Health Sciences (USUHS) using the TruSeq DNA PCR-Free library preparation kit and sequencing on the Novaseq 6000 (Illumina, San Diego, CA). WGS was analyzed through a bioinformatics pipeline including alignment to the GRCh38 genome build with BWA mem ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were created from DNA of the same HzStark_Cry1AcR male using the TruSeq DNA PCR-Free Low Throughput Library Prep Kit with TruSeq DNA UD Indexes (Illumina, San Diego, CA, USA) to yield a standard paired end library with a 350±50 bp insert size ...
-
bioRxiv - Zoology 2022Quote: ... Twelve 150 bp paired-end libraries (six for the Mamm01 primer set and six for the MiFish-U primer set) were prepared with an Illumina TruSeq DNA PCR-free LT Sample Prep kit (Illumina, San Diego, California), spiked with 8% phiX ...
-
bioRxiv - Genomics 2023Quote: ... The tagmentation and library preparation was performed with the Nextera DNA Library Preparation Kit with 8 cycles of PCR amplification (Illumina #FC-121-1030).
-
bioRxiv - Genetics 2023Quote: ... Sequencing libraries of individual DNA samples were prepared using the Illumina TruSeq DNA PCR-free LP kit (Illumina, San Diego, California, United States) in combination with the IDT for Illumina TruSeq DNA UD indexes kit (Illumina) ...
-
bioRxiv - Immunology 2024Quote: ... Sequencing of the PCR amplicons spanning the MHC loci was performed on the Illumina MiSeq platform using a v2 500-cycle kit (Illumina, San Diego, CA) in the FHCC Genomics Core Facility or the UCI-Fred Hutch Cancer Centre Laboratory.
-
bioRxiv - Genomics 2019Quote: ... 1μL SR RT Primer and following the manufacturers protocol (NEB small RNA for Illumina library prep); “Hybridize the reverse transcription primer” followed by “ligate 5’ SR adaptor…” ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: Quantitative PCR (qPCR) was carried out on an Illumina Eco Real-Time PCR platform (Illumina, Melbourne, Australia), following the protocol outlined by Barrett-Manako and colleagues (Barrett-Manako et al. ...
-
bioRxiv - Genomics 2020Quote: ... fragment libraries (average fragment sizes of ∼560 bp) were constructed using TruSeq DNA PCR-Free LT Library Prep Kit (Illumina, San Diego, CA, USA). Paired-end sequences of 150 bp long were determined using HiSeq X (Illumina) ...
-
bioRxiv - Molecular Biology 2019Quote: The extracted genomic DNA from a laboratory-reared individual was used in constructing a high-throughput sequencing library with 500-bp insert size using the Illumina TruSeq DNA PCR-Free HT Library Prep Kit (Illumina, San Diego, CA, USA). The prepared library was sequenced on an Illumina Hiseq4000 Sequencer using the Hiseq Reagent Kit v3 (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... An average 350-bp paired-end libraries were prepared from extracted genomic DNA by TruSeq DNA PCR-Free High Throughput Library Prep Kit (Illumina, San Diego, CA, USA). Pair-end sequencing (2× 150-bp ...
-
bioRxiv - Plant Biology 2021Quote: Libraries for PCR-free short read sequencing were prepared from MN106-Ref genomic DNA using the TruSeq DNA PCR-Free Low Throughput Library Prep Kit (Illumina, San Diego, CA, USA) in combination with TruSeq DNA Single Indexes Set A (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... Eight whole genome sequencing libraries with a median insert size of 550 bp were constructed using the Illumina TruSeq DNA PCR-free sample preparation kit (Illumina, San Diego, CA, USA), according to manufacturer’s protocols ...
-
bioRxiv - Microbiology 2022Quote: ... a paired-end metagenomic library was prepared from 100 ng of DNA using the DNA PCR free Library Prep Kit (Illumina, San Diego, CA, USA) and size selected at about 400 bp ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 16 PCR positive controls) was sequenced on an Illumina MiSeq® using a MiSeq Reagent Kit v3 (600-cycle) (Illumina, Inc, CA, USA). Raw sequence reads were demultiplexed using a custom Python script ...
-
bioRxiv - Microbiology 2019Quote: ... the amplicon libraries underwent a second PCR reaction to attach dual indices and Illumina sequencing adapters using the Nextera XT index kit (Illumina, San Diego, CA, USA). Following purification (as described above ...
-
bioRxiv - Pathology 2020Quote: The V3-V4 hypervariable regions of the 16S_rDNA were amplified by two steps PCR using v1 primers (Vaiomer) and sequenced using MiSeq Reagent Kit v3 (2×300 bp Paired-End Reads, Illumina, San Diego, CA, USA) as previously described [24] ...
-
bioRxiv - Genomics 2021Quote: ... libraries with an average insert size of 450 bp were prepared by the University of Utah’s Huntsman Cancer Institute High-Throughput Genomics Core Facility using the Illumina TruSeq DNA PCR-Free Library Prep Kit (Illumina, San Diego, California, USA). 2 × 150 bp reads for each parent were generated on an Illumina NovaSeq 6000 instrument using the NovaSeq S2 reagent kit (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... Paired-end sequencing libraries were constructed with an insert size of 500 bp using a TruSeq DNA PCR-Free kit (Illumina, San Diego, CA, USA) according to Illumina library preparation protocols ...
-
bioRxiv - Cell Biology 2022Quote: ... as described in the section “Quantitative real-time PCR.” The library was prepared using the TruSeq stranded mRNA sample prep kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions and sequenced on an Illumina NovaSeq 6000 platform in the 101 bp single-end mode ...
-
bioRxiv - Genomics 2022Quote: ... 2 μg of Rohu-1 genomic DNA was used with an Illumina TruSeq DNA PCR-free Library Prep Kit (Illumina, San Diego, CA, USA) to create an Illumina sequencing library ...
-
bioRxiv - Microbiology 2022Quote: ... Purified PCR products were fragmented and tagged with the indexed adaptors using the Nextera DNA XT Sample Preparation Kit (Illumina, San Diego, CA, USA). The sequence library was quantified by using the Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... Lentiviral sgRNA inserts were amplified in a two-step PCR (with Illumina adapters added on the second PCR), as previously described39 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 100bp TruSeq DNA PCR-free libraries (Illumina) were prepared according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... an Eco Real-Time PCR System (Illumina) or a 7500 Real Time PCR System (Applied Biosystems).
-
bioRxiv - Genomics 2022Quote: ... TruSeq DNA PCR free (Illumina Inc., USA) and Collibri PCR free PS DNA (ThermoFisher ...
-
bioRxiv - Immunology 2021Quote: ... 25 μl PCR master mix (Nextera, Illumina) and 5 μl indexed amplification primers59 (0.125 μM final concentration ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... or Eco Real-Time PCR System (Illumina) using SuperScript One Step RT-PCR kit (Life Technology) ...
-
bioRxiv - Genomics 2023Quote: ... 100bp TruSeq DNA PCR-free libraries (Illumina) were prepared according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... After A-tailing and adaptor ligation fragments that carry adaptors on both ends were enriched by 8 cycles of PCR (Illumina TruSeq Nano DNA Sample Kit). The final library was quantified using PicoGreen (Quant-iT ...
-
bioRxiv - Microbiology 2019Quote: ... A library was prepared by adaptor ligation with the PCR primer pairs using the TruSeq Nano DNA Library Prep Kit (Illumina, Inc., San Diego, CA, USA). When two or more bands were detected using 1.5%-agarose gel electrophoresis ...
-
bioRxiv - Immunology 2020Quote: ... before fragmenting the samples to 450bp fragments and processing with the Illumina TruSeq DNA PCR-Free Sample Preparation kit (Illumina Inc., San Diego, CA, USA). Over the three-year duration of the sequencing phase of the project ...
-
bioRxiv - Microbiology 2021Quote: ... A library was prepared by adaptor ligation with the PCR primer pairs using the TruSeq Nano DNA Library Prep Kit (Illumina, Inc., San Diego, CA, USA). When two or more bands were detected using 1.5%-agarose gel electrophoresis ...
-
bioRxiv - Cell Biology 2022Quote: ... Tagmentation products were amplified by PCR by adding 1.25 µl of each N and S primers (Illumina Nextera XT 96-index kit FC-131- 1002) and 3.75 µl of NPM solution and using the following thermocycler settings ...
-
Legionella relative abundance in shower hose biofilms is associated with specific microbiome membersbioRxiv - Microbiology 2023Quote: ... The second PCR (adaptor PCR) was performed with limited cycles to attach specific sequencing Nextera v2 Index adapter (Illumina). After purification ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... pre-amplified samples were used for TaqMan quantitative PCR which was performed on Eco Real-Time PCR System (Illumina) using gene specific primers purchased from Fluidigm (DELTAgene Assay ...
-
bioRxiv - Cell Biology 2022Quote: ... 10μl of the tagmented chromatin was mixed with 2.5μl of Nextera PCR primer cocktail and 7.5μl of Nextera PCR master-mix (Illumina FC-121-1030) in low-binding PCR tubes ...
-
bioRxiv - Microbiology 2024Quote: ... The second PCR (adaptor PCR) was performed with limited cycles to attach specific sequencing Nextera v2 Index adapter (Illumina). After purification ...
-
bioRxiv - Genomics 2019Quote: ... and reverse transcribed using 25 pmol RT primer (5’-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3’) for TRU-seq barcodes (RP1 primer, Illumina). A portion of the RT product was removed and used for trial amplifications to determine the optimal number of PCR cycles ...
-
bioRxiv - Microbiology 2020Quote: ... A second PCR was performed to attach dual indices and Illumina® sequencing adapters using the Nextera XT Index kit (Illumina®; San Diego, CA, USA). The conditions of this PCR included ...
-
bioRxiv - Cell Biology 2020Quote: ... The PCR products were purified using Expin™ PCR SV mini (GeneAll) and sequenced using a MiniSeq Sequencing System (Illumina). The results were analyzed using Cas-Analyzer (http://www.rgenome.net/cas-analyzer/ ...
-
bioRxiv - Neuroscience 2021Quote: ... Universal adapters were ligated followed by 10 cycles of PCR using Illumina PCR Primer Cocktail and Phusion DNA polymerase from Illumina. Subsequent library purification with Agencourt AMPure XP beads was validated with Agilent Bioanalyzer 2100 ...
-
Therapeutic base and prime editing of COL7A1 mutations in recessive dystrophic epidermolysis bullosabioRxiv - Bioengineering 2021Quote: ... The PCR products were purified using Expin™ PCR SV mini (GeneAll) and sequenced using a MiniSeq Sequencing System (Illumina). The results were analyzed using Cas-Analyzer (http://www.rgenome.net/cas-analyzer/) ...
-
bioRxiv - Microbiology 2020Quote: ... Tagmented DNA fragments were enriched by 10 cycles of PCR amplification using PCR master mix and primers with the index from Illumina. Libraries were quantified by the KAPA SYBR fast quantitative PCR kit (Life Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... the 309 bp sequence of the nodD coding region was amplified by PCR from the DNA extractions and the PCR products were sequenced by Illumina MiSeq 2×250 bp technology as described in Methods S5 ...
-
bioRxiv - Bioengineering 2023Quote: ... The DNA fragments around the crRNA target site were amplified by a two-step PCR with specific primer sets (Table S2) and Index PCR Primers mentioned in the manufacturer’s instructions (Illumina, USA). After gel purification ...
-
bioRxiv - Genetics 2023Quote: ... dsODN specific PCR products were used for indexing PCR using 2x Platinum SuperFi PCR Master mix and i5 primer: AATGATACGGCGACCACCGAGATC and i7 indexing primers (Illumina) following the cycling conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.33 μL of the PCR product was then used for a second PCR reaction to attach the TruSeq UDI (Illumina) indexes ...