Labshake search
Citations for Illumina :
401 - 450 of 521 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... TASSEL 5 GBS v2 pipeline (52) was used to perform the SNP calling of the sequence data obtained from Illumina sequencing ...
-
bioRxiv - Genetics 2021Quote: ... The bone and reference captured library pools were diluted to 1 pM with a 5% spike-in of PhiX Control V3 (Illumina) for sequencing on a NextSeq 550 (Illumina ...
-
bioRxiv - Physiology 2021Quote: ... Single-indexed strand-specific cDNA library from total RNA samples (500 ng input with RIN ≥ 5) was prepared using TruSeq Stranded mRNA Library Prep Kit (Illumina) as per directions by the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... 1.5 μg of purified RNA for each sample was processed using the Ribozero rRNA Removal Kit (Gram-negative bacteria) (Illumina) according to the manufacturer’s instructions except that reaction volumes were reduced by 50% ...
-
bioRxiv - Genetics 2021Quote: ... and ribosomal RNA was depleted from 5 ug of total RNA using the Ribo-Zero™ Gold Kit (Illumina, Inc.). Depleted mRNA was fragmented and converted to first strand cDNA ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... The rRNA-depleted samples were used for TruSeq Stranded RNA Sample Prep kit to produce 5′ to 3′ strand-specific cDNA libraries (Illumina). A TruSeq SBS sequencing kit version 3 (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting 10 nM pool was denatured to 10 pmol with 5% PhiX spike-in and sequenced as single-read on HiSeq 2500 (Illumina) in rapid mode for 51 cycles (plus 7 cycles index read ...
-
bioRxiv - Microbiology 2021Quote: ... Total 5 μg of RNA was used for rRNA depletion by using Ribo-Zero™ (Epicentre, Illumina, Madison, WI USA) kit and purified by using Qiagen-RNeasy miniElute (Qiagen GmbH ...
-
bioRxiv - Immunology 2020Quote: ... 0.3 to 0.5 ng of pre-amplified cDNA was used to generate barcoded Illumina sequencing libraries (Nextera XT library preparation kit, Illumina) in an 8μL reaction volume ...
-
bioRxiv - Genomics 2021Quote: ... The 20 ul preamp was then mixed with 25 ul TD buffer and 5 ul TDE1 buffer (Nextera kit, FC-131-1096, Illumina) and incubated for 5 min at 55 C and held at 10 C ...
-
bioRxiv - Microbiology 2023Quote: ... 3-5 µg of each sample was treated with Ribozero® rRNA Removal Kit according to the manufacturer’s instructions (Illumina, USA ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Microbiology 2023Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110- 3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Neuroscience 2022Quote: ... Each pool was sequenced on the Illumina NextSeq 500 after the addition of 5% PhiX sequencing control library (FC-110-3002; Illumina) using the following settings ...
-
bioRxiv - Genomics 2024Quote: ... A 2.5-kb ‘jumping’ library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced on an Illumina HiSeq 2000 ...
-
bioRxiv - Immunology 2024Quote: ... the antibody barcode library was pooled at a ratio of 1:5 with the gene expression library and sequenced on a NextSeq 2000 (Illumina) to an average depth of 34,000 reads per cell.
-
bioRxiv - Cell Biology 2023Quote: ... 30 sec at 62°C and a final extension step of 5 min at 62°C) and sequenced using the NOVASeq platform (Illumina).
-
bioRxiv - Genetics 2023Quote: ... Plasma was divided from maternal peripheral blood (5[mL) by centrifuging and then 600[μL (Ion Torrent) or 1.4 mL (Illumina CN500) plasma was used to extract cell-free DNA ...
-
bioRxiv - Immunology 2023Quote: ... ADT and 3’ Gexp libraries were mixed at the ratio of 1:5 and sequenced on NovaSeq 6000 sequencer (Illumina) with a configuration of 28/8/0/91-bp for cell barcode ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were pooled at a concentration of 5 nM and run on an Illumina HI-SEQ 2500 sequencer (Illumina) to obtain paired-end reads of 75 bases (PE75) ...
-
bioRxiv - Genetics 2024Quote: ... The libraries were amplified for 5 cycles and sequenced in 2×75-bp paired-end mode with NextSeq 500 sequencing technology (Illumina), per the manufacturer’s recommendations.
-
bioRxiv - Genomics 2023Quote: ... We used 15 mins incubation on ice in the nuclei preparation step and the Tn5 reaction was performed in 50 μl of custom transposition buffer (10 mM Tris pH 8, 5 mM MgCl2 and 10% dimethylformamide) with 2.5 μl Tn5 transposase (Illumina, 20034197) at 37°C while mixing at 1000 rpm for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... The transposon-specific primer was designed to include (from 5’ to 3’): (i) the “P5” or “P7” flow-cell annealing sequence (Illumina), (ii ...
-
bioRxiv - Genomics 2023Quote: ... groups was based on 5 μg of total RNA according to the manufacturer’s protocol using the Illumina HiScanSQ Instrument (Illumina, USA) and sequenced in the same flow cell as paired-end (2 × 100 bp) ...
-
bioRxiv - Microbiology 2024Quote: ... All samples were pooled to a final concentration of 5-10 ng/µL and sequenced on a NextSeq 500 (Illumina). The demultiplexed data was assembled and SNPs detected with Pilon software using reference genome sequences.84
-
bioRxiv - Microbiology 2022Quote: ... Ribosomal RNA (rRNA) was subsequently depleted from each RNA sample (5 µg each) using the bacterial Ribo-Zero rRNA Removal Kit (Illumina). The integrity of the RNA was evaluated using an RNA 6000 Nano LabChip and an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... A 2.5 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced at the Broad Institute Genomics Platform on an Illumina HiSeq 2000 system to generate paired 101-base reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’) and Reverse Library primers (5’CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATC3’, where NNNNNN denotes the barcodes, e.g. Index1 is CGTGAT for Illumina sequencing). Three rounds of agarose gel purification were performed to purify the fragments of 200~650 bp using QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing was performed at 5 million reads/sample in single-end mode with 150 nt read length on the NextSeq 500 platform (Illumina) using a Mid output sequencing kit ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified with AMPure XP purification kit and Sixteen-plexed samples were pooled in approximately equimolar amounts of 5 nM and run in a single and double index reads on a Hiseq 4000 (Illumina).
-
bioRxiv - Genomics 2022Quote: Small RNA libraries were prepared starting from 5 µL RNA eluate using the TruSeq Small RNA Library Prep Kit (Illumina, RS-200-0012 ...
-
bioRxiv - Cancer Biology 2023Quote: RNA-seq libraries were prepared with 0,5-1 µg of total high quality RNA collected from samples and the Illumina Stranded Total RNA Prep kit (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Illumina sequencing libraries were indexed with unique 5’ and 3’ barcode combinations (up to 384 cells) using the Nextera XT DNA library preparation kit (Illumina). Libraries were pooled and size-selected with 0.9X AmpPure XP beads ...
-
bioRxiv - Cancer Biology 2024Quote: ... Purified PCR products were pooled 1:1 and a 5% PhiX DNA spike-in was included and sequenced by Illumina HiSeq PE150 platform at Novogene ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA was dephosphorylated in 3’ and then phosphorylated in 5’ to generate cDNA libraries using the NebNext Small RNA Sample Prep kit with 3’ sRNA Adapter (Illumina) according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: The reverse transcription products (5 μL) were mixed with Eco™ Real-Time PCR System (Illumina, San Diego, CA, USA) and primers ...
-
bioRxiv - Developmental Biology 2024Quote: ... Gene expression and CRISPR libraries were prepared according to the CG000510 Chromium NextGEM Single Cell 5’ v2 CRISPR User Guide (Rev B, 10x Genomics) and sequenced on NextSeq and NovaSeq platforms (Illumina).
-
bioRxiv - Systems Biology 2024Quote: ... The quality of each sequencing run was controlled by adding up to 5% of denatured and diluted down to 20pM PhiX (Illumina). Demultiplexing of the data by sample using the defined index pairs was performed automatically by Illumina BaseSpace.
-
bioRxiv - Evolutionary Biology 2024Quote: ... Denatured libraries were diluted to a final concentration of 12 pM and combined with 5 % PhiX control (V3 cat# 15017666 from Illumina). Paired-end sequencing was performed on an Illumina MiSeq with 2×150 bp reads (MiSeq Reagent Kit v2 600-cycle ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.4 μg total RNA was used for RNA-seq library construction by a TruSeq RNA Library Prep Kit V2 (Illumina, RS-122-2001). Both ChIP-seq and RNA-seq libraries were sequenced at the Bauer Core Facility ...
-
bioRxiv - Cancer Biology 2020Quote: ... and centrifuged at 500 g at 4° C to isolate nuclear pellets that were treated in 50 μL reactions with Nextera Tn5 Transposase (Illumina, FC-121-1030) for 30 min at 37° C ...
-
bioRxiv - Genomics 2021Quote: ... The PCR products (4 nM from every single cell) were treated with the Miseq Reagent Kit v2 50 Cycles (Illumina KK, Tokyo, Japan) and sequenced by the MiSeq sequencer (26 bp ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR products (4 nM from every sample) were treated with the MiSeq Reagent Kit v2 (50 cycle format; Illumina KK, Tokyo, Japan) and sequenced using the MiSeq Sequencer (26 bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 μg total RNA was used to prepare RNA-seq libraries using the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, US). Strand specific paired-end mRNA sequencing was performed on DNBSEQ platform at the Next-Generation Sequencing Core of the BGI Genomics Service (Hong Kong ...
-
bioRxiv - Microbiology 2022Quote: ... for amplicon sequencing of the V3-4 hypervariable region of the 16S rRNA gene (position 341-806) on a MiSeq desktop sequencing platform (Illumina, San Diego, CA) operated under paired-end mode ...
-
bioRxiv - Microbiology 2022Quote: ... for amplicon sequencing of the V3-4 hypervariable region of the 16S rRNA gene (position 341-806) on a MiSeq desktop sequencing platform (Illumina, San Diego, CA) operated under paired-end mode ...
-
bioRxiv - Genomics 2022Quote: ... spun at 300G for 12 min at 4 ºC and resuspended in 20 uL transposition mix: 1X TD buffer and 2 uL of TDE1 (Illumina #FC-121-1030), 0.01% Digitonin in DMSO ...
-
bioRxiv - Genetics 2023Quote: ... and 4 μl of bisulfite-converted DNA was measured on the Illumina HumanMethylation450 array using the manufacturer’s protocol (Illumina, San Diego, CA, USA). Preprocessing and normalization of the data were done using DNAmArray workflow previously developed by our group (https://molepi.github.io/DNAmArray_workflow/) ...
-
bioRxiv - Genomics 2023Quote: ... 4 μl of 1 ng amplicon DNA was combined with a mix containing 1 μl of Amplicon Tagment Mix (Illumina, FC- 131-1096) and 5 μl of Tagment DNA Buffer (Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... A Qubit 2.0 Fluorometer was used to calculate RNA concentration and 4 mg of total RNA was used to prepare libraries with the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, US). Single-end sequencing (50bp ...