Labshake search
Citations for Illumina :
201 - 250 of 521 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... The 5’gene expression libraries were sequenced in NextSeq or NovaSeq6000 sequencer (Illumina) using NextSeq 500/550 v2.5 sequencing reagent kit (read length ...
-
bioRxiv - Immunology 2021Quote: ... 0.01% digitonin and 5 μl of Tn5 from the Nextera kit from Illumina, Cat ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... 5 µl nuclease and 2.5 µl Tn5 transposase enzyme (TDE1, Illumina, catalog # 15027865) and incubated for 28 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... with a loading sample concentration of 10pM and a 5% PhiX (Illumina, U.S.) spike-in ...
-
bioRxiv - Genomics 2023Quote: ... the 5’ Illumina adapter (as used in the Illumina TruSeq Small RNA kit) and a split 2x 3 nt Unique Molecular Identifier (UMI ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli transposition assays were mixed with 5 µL of tagmentation DNA buffer (Illumina) and 1 µL of amplicon tagmentation mix (Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: ... The pellet was resuspended in transposition solution containing 5 μL TDE1 (Illumina, 15027865) 25 μL 2x buffer (Illumina ...
-
bioRxiv - Physiology 2020Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample ...
-
bioRxiv - Microbiology 2023Quote: ... a 4 nM library was sequenced on the Illumina Nextseq500 platform (Illumina, San Diego, CA) at the Radboudumc sequencing facility ...
-
bioRxiv - Systems Biology 2023Quote: ... allowing 4 lanes of 10x to be sequenced per NovaSeq S1 flow cell (Illumina #20028319) using a 28bp read 1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA-seq libraries were generated using Illumina SureCell WTA 3’ Library Prep Kit for the ddSEQ System (6 cartridge version, cat.no. 20014280, Illumina, San Diego, CA, USA). Libraries were assessed for quality ...
-
bioRxiv - Microbiology 2021Quote: ... The library was loaded at 6 pM and sequenced using the Miseq Reagent Kit v3 (600-cycle) (Illumina; catalog no., MS-102-3003).
-
bioRxiv - Plant Biology 2020Quote: ... Genomic DNA from infected barley leaves at 6 days post-inoculation (dpi) was isolated by using the MasterPure™ Complete DNA&RNA purification Kit (Epicentre®, Illumina®) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: ... was hybridized overnight at 58°C to the SentrixMouseWG-6 Expression BeadChip or humanHT-12 Expression BeadChip (>46,000 gene transcripts; Illumina, San Diego, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The library was loaded at 6 pM and sequenced using the Miseq Reagent Kit v3 (600-cycle) (Illumina; catalog no., MS-102-3003).
-
bioRxiv - Immunology 2020Quote: ... The plates were then pooled in equal volumes and the pooled library was then diluted to 6 μM and sequenced using a 500-cycle V3 reagent on an Illumina MiSeq (Illumina, San Diego, CA), which yields 25 million paired reads of 250 base pairs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Illumina sequencing libraries with 6-bp single indices were constructed from 1 μg total RNA using the TruSeq Stranded mRNA LT kit (Illumina, RS-122-2101). The resulting library was validated using the Standard Sensitivity NGS Fragment Analysis Kit (AATI ...
-
bioRxiv - Genomics 2022Quote: ... Mixed nucleic acid (DNA and cDNA) from all samples were subjected to library construction using Nextera XT DNA Sample Preparation Kit (Illumina Inc., San Diego, USA) and sequenced on an Illumina MiSeq platform (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1.25 µL each of i5 and i7 indexing primers (Illumina, diluted 1:5). The samples were indexed with the following PCR cycles ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Diluted libraries were spiked with 5% Phi-X control (Illumina, San Diego, CA, USA) and sequenced using the Illumina MiSeq (Illumina Inc. ...
-
bioRxiv - Molecular Biology 2022Quote: ATAC-seq was conducted on 5×104 live cells using Nextera Tn5 transposase (Illumina) as previously described (Buenrostro et al. ...
-
bioRxiv - Immunology 2022Quote: ... 5’ expression library was sequenced with NovaSeq 6000 S1 (100 cycles) (Illumina, cat. 20012865) and the V(D)J library was sequenced with NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 U of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 μl and incubated at 25°C for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 units of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 µl and incubated at 25°C for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 µL of the Illumina PCR Primer Cocktail (PPC, Illumina FC-121-1030). PCR conditions were as follows ...
-
bioRxiv - Genetics 2020Quote: ... Pooled and denatured library (8 pM) containing 5% volume of PhiX (control library; Illumina) was sequenced using the Illumina MiSeq system with MiSeq Reagent Kit V3 (300-bp paired-end reads ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Primer Cocktail (Nextera DNA Sample Preparation Kit and Nextera Index Kit, Illumina). Amplification was performed in a Veriti 96 Well Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library amplification was performed using 5 μL Nextera XT i7 forward index primer (Illumina) and 5 μL custom i5 index primers (2 μM ...
-
bioRxiv - Immunology 2024Quote: ... Sequencing of 5’ gene expression libraries was performed on an Illumina NextSeq 2000 (Illumina) using P3 reagent kits (100 cycles) ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were sequenced using the llumina NextSeq 550 platform with 5% PhiX (Illumina) spike-in ...
-
bioRxiv - Cancer Biology 2024Quote: ATAC-seq was conducted on 5 × 104 live cells using Nextera Tn5 transposase (Illumina) as previously described 31 ...
-
bioRxiv - Genomics 2020Quote: ... The remaining 1μl re-dissolved contents were tagmented using 0.6 μl TD Tagmentation buffer and 0.3 μl ATM Tagmentation enzyme from Nextera XT DNA Library Prep Kit (Illumina, catalog no. FC-121-1030) for 5min at 55 °C ...
-
bioRxiv - Genetics 2021Quote: ... multiplexing library preparation with a uniquely tagged 6-bp sequence index was performed following the standard Illumina library construction protocol (Illumina, San Diego, California, USA). The libraries with average insert size 250-300 bp were sequenced using an Illumina Novaseq sequencer ...
-
bioRxiv - Plant Biology 2022Quote: ... The GBS library was diluted to 3.6 pM and sequenced on one lane (single end, 101 base pair read length) of an Illumina HiSeq 2500 (Illumina Inc, San Diego, CA) at the Genomics Resources Core Facility (Weill Cornell Medicine ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... RNA (n = 6) and DNA (n = 8) metage-nomic libraries were prepared and run on an Illumina HiSeq 2500 platform (Illumina, San Diego, CA, USA) at Génome Québec in a paired-end 125 bp configuration ...
-
bioRxiv - Cancer Biology 2021Quote: ... and sequenced on an Illumina HiSeq 2000 sequencer (RRID:SCR_020132, v.4, Illumina, San Diego, California, USA) in 50 bp single-end mode by Genomics and Proteomics Core facility ...
-
bioRxiv - Genomics 2024Quote: ... samples were incubated in cleavage mix (MiSeq Nano kit v2 reagent 4) (Illumina MS-103-1003) for 6 min at 60 °C ...
-
bioRxiv - Microbiology 2022Quote: ... and diluted to 4 nM for sequencing on an Illumina MiSeq (Illumina, San Diego, CA, USA). A 500 cycle MiSeq Reagent kit v2 (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... The different libraries were pooled according to the effective concentration and the target amount of data – 6 Gb raw data per sample – and were sequenced by the Illumina NovaSeq 6000 (Illumina Inc., San Diego, CA, USA). Paired-end 150bp reads were generated.
-
bioRxiv - Pathology 2021Quote: ... with the libraries clustered at 12-15pM and mixed with 5% PhiX genomic DNA (Illumina).
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were diluted and mixed with 5-20% phiX control v3 (Illumina FC-110-3001) and sequenced with oSK326 for read 1 and oSK324 for the index read.
-
bioRxiv - Cell Biology 2023Quote: ... and 5-day deligated samples were sequenced (the ligated sample was sequenced on the Illumina Nextseq500 and all others were sequenced on the Illumina Nextseq2000) ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...
-
bioRxiv - Microbiology 2023Quote: ... all libraries were spiked with 5% PhiX Control v3 (Illumina, Catalog No. FC-110-3001). The NCBI Genbank accession number for the raw sequencing data reported here is PRJNA999749.
-
bioRxiv - Genomics 2024Quote: ... were dual-indexed using differing barcode indexes both for the forward (5’ P5 Illumina adapter) and reverse oligos (3’ P7 Illumina adapter) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1,6 pM of libraries with 5% PhiX was then loaded on a NextSeq 500 (Illumina) for a 75 bp paired-end sequencing run at the Research Sequencing Facility of ERIBA (UMCG).
-
bioRxiv - Genomics 2020Quote: ... denatured and diluted to 4 pM before loading onto the MiSeq flow cell (Illumina Inc., United States). According to Illumina protocol ...