Labshake search
Citations for Illumina :
351 - 400 of 521 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing libraries were prepared according to the TruSeq stranded mRNA library preparation kit (Illumina, Inc., Cat No.20020594/5) including poly-A selection ...
-
bioRxiv - Genomics 2020Quote: ... Next nuclei were pelleted and the transposition reaction was performed incubating the lysate for 30 min at 37 °C under agitation in the presence of Transposition mixture (Tris-HCl pH 7.6 10 mM, MgCl2 5 mM, dimethyl formamide 10%, Tn5 enzyme 100 nM – Illumina #20018704 ...
-
bioRxiv - Genetics 2020Quote: ... Globin and rRNA sequences were depleted from up to 5 µg of treated RNA using Globin-Zero Gold (Illumina), before PolyA selection with NEBNext Poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... 5 µg fragmented RNA was used for ribosomal RNA removal using Ribo-Zero Gold rRNA Removal Kit (MRZG12324 Illumina) according to Illumina’s protocol for TruSeq Ribo Profile Kit (RPHMR12126 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL of the sample was then further diluted and denatured with 5 µL 0.1N NaOH and 490 µL HT1 buffer (Illumina). Samples were sequenced on a HiSeq2500 HighOutput (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of the 4nM library pool was denatured with 5 μl 0.2N of NaOH and diluted using the HT1 Hybridization Buffer (Illumina) to a concentration of 8 pM for amplicon samples and 10 pm for whole-genome samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The chromatin was then tagmented by resuspending beads in 29 µl Tagmentation Buffer (10 mM Tris-HCl pH 8.0, 5 mM MgCl2, 10% dimethylformamide) and adding 1 µl of transposase (Illumina). Samples were incubated at 37 °C for 10 min and the reaction was terminated by adding 150 µl RIPA buffer ...
-
bioRxiv - Pathology 2022Quote: ... Finally, the libraries of multiplexes (control, 5 samples; schizophrenia, 10 samples) were pooled and analyzed using Illumina HiSeq1500 (Illumina).
-
bioRxiv - Genetics 2020Quote: ... and IV-5) individuals were genotyped using the Infinium Global Screening Array-24 v1.0 BeadChip (Illumina, SanDiego, CA, USA) according to manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dual indexed sequencing libraries were made out of 5 ng cDNA from the above preparations using Illumina Nextera library preparation kit according to manufacturer’s instructions (Illumina). Quality checked and equimolar pooled libraries were sequenced in a HiSeq 4000 Illumina system ...
-
bioRxiv - Cell Biology 2020Quote: ... rRNA was depleted from 5 μg of total RNA using the Ribo-Zero Gold Yeast rRNA Removal Kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... since values ΔCq > 5 are not suitable for further downstream processing for Infinium HD FFPE Restore Protocol (Illumina, Inc.) and Infinium MethylationEPIC array (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... and 5K samples were resuspended in 50 μl, 10 μl, and 5 μl of transposition mix (25 μl 2x TD buffer, 2.5 μl Tn5 (Illumina), 16.5 μl PBS (Invitrogen) ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were equimolarly pooled and 1.8 pM of the pool with 5% PhiX were loaded on a NextSeq 500 (Illumina) for a 75 bp paired-end sequencing run at the Research Sequencing Facility of ERIBA (UMCG).
-
bioRxiv - Physiology 2024Quote: ... tagmented DNA was amplified by PCR in a reaction mix (5 µL DNA, 2.5 µL of 25 μM forward primer (Nextera/Illumina i5 adaptors (Illumina)) ...
-
bioRxiv - Cancer Biology 2022Quote: Gene expression data was generated with the Chromium Single Cell 5’ v3.1 assay (10X Genomics) and sequenced on the NovaSeq 6000 platform (S1 flow cell, Illumina). To generate gene-barcode count matrices ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of Index primer (both provided in NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2), and 25 μl NEBNext Ultra II Q5 Master Mix (PCR cycling conditions ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were equimolarly pooled and 1.8 pM of the pool with 5% PhiX were loaded on a NextSeq 500 (Illumina) for a 75 bp paired-end sequencing run at the Research Sequencing Facility of ERIBA (UMCG).
-
bioRxiv - Microbiology 2024Quote: ... to which 5 µl of P7 and P7 of Nextera XT Index Kit v2 index primers (Illumina, Cambridge, UK) and 7 µl of the previous tagmentation reaction were added ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 ul of Tn5 tagmentation mix (1X Tagment DNA buffer, Illumina; ATM mix, Illumina and cDNA library 1 ng) was prepared for cDNA fragmentation ...
-
bioRxiv - Genomics 2024Quote: ... libraries were amplified for 5 cycles with 0.5 μl i5 and i7 Nextera adapters (10 μM) following the instructions provided by Illumina. Finally ...
-
bioRxiv - Genetics 2024Quote: ... 5 µg of total RNA for each sample was then processed using the Tru-Seq stranded mRNA kit (Illumina) following manufacturer instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries for 5 biological replicates were pooled and 100bp paired end reads were generated on a NovaSeq 6000 (Illumina). Reads were trimmed and quality filtered using TrimGalore with a minimum phred score of 20 then aligned to hg19 using STAR 64 with quantMode to obtain read counts ...
-
bioRxiv - Genetics 2021Quote: ... Individual libraries were pooled in equimolar ratio (4 nM for each) and sequenced with the Nextseq 550 platform (Illumina, San Diego, California) in a single end 75 cycles high output run ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Libraries were diluted from 26.2 nM (HBA1) and 33.4 nM (HBA2) to a concentration of 4 nM and pooled for sequencing on a MiSeq (Illumina, San Diego, CA).
-
bioRxiv - Cancer Biology 2023Quote: ... 4) tagmentation was performed with 2ng input and sequencing library generated using the Nextera XT library prep kit (Illumina, #FC-131-1024). In short ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were diluted to a final concentration of 4 nM and sequenced with the NextSeq 500/550 HighOutput Kit v2.5 (75 cycles, Illumina, cat. no. 20024906), with 75 bp reads and pair-end sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... Purified cells were lysed in ATAC lysis buffer for 5 min to get nuclei and then transposed with Tn5 transposase (Illumina) for 30 min ...
-
bioRxiv - Microbiology 2021Quote: PCR free shotgun libraries were prepared for each sample from 2.5 ug metagenomic DNAs by Exeter Sequencing Service for the metagenomic sequencing using the TruSeq DNA library Prep Kit (Illumina). The libraries were sequenced to approximately 7GBp using the HiSeq 2500 rapid run mode (2X 250 bp paired end ...
-
Diversified expression of gamma-protocadherins regulates synaptic specificity in the mouse neocortexbioRxiv - Neuroscience 2021Quote: We acquired 212.66 GB clean reads for the 5’ gene expression library and 183.30 GB for the 5’ pcdhg expression library from the sequencing platform NovaSeq 6000 (Illumina, Novogene). 5’ gene expression sequencing data were aligned by Cellranger v3.0.2 (10X Genomics) ...
-
bioRxiv - Genetics 2020Quote: ChIP-seq and DNase-seq libraries were prepared from 1-5 ng ChIP DNA or DNase DNA samples using NEBNext Ultra II DNA library Prep Kit (Illumina). Libraries were sequenced on an Illumina NextSeq 500 with single-end or paired-end 75 bp reads.
-
bioRxiv - Genomics 2021Quote: ... cDNA and barcode libraries were checked for quality on an Agilent 4200 TapeStation, quantified by KAPA qPCR, and sequenced on a single lane (95% transcriptome, 5% barcode) on Novaseq6000 (Illumina) to an average depth of 100,000 reads per cell.
-
bioRxiv - Genomics 2021Quote: ... Libraries were pooled and sequenced single-end for 75 cycles on one high-output flow cell of an Illumina NextSeq with 5% PhiX control (Illumina) added to provide sequence diversity ...
-
bioRxiv - Genomics 2021Quote: ... Following immunoprecipitation with Dynabeads Protein G beads (invitrogen) in PCR tubes, samples were subject to Tagmentation (5 µl Tagmentation Buffer, 1 µl Tagmentation DNA Enzyme (Illumina), 19 µl Nuclease free water ...
-
bioRxiv - Systems Biology 2020Quote: ... Sequencing was performed using custom read primer oligo1210 (5’-CTTGTGGAAAGGACGAAACACCGGTAATTTCTACTCTTGTAGAT) (HPLC purified, Integrated DNA Technologies) using NextSeq 1 × 75 nt High Output reagents (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... a PhiX spike-in of 2.5-5% was added to the pools (PhiX Sequencing Control v3; Illumina # FC-110-3001). Samples were run on the Illumina NextSeq 500 ...
-
bioRxiv - Microbiology 2021Quote: ... 50 ng of each amplicon was dual indexed in a 5-cycle PCR reaction using the PCR module and indexed primers from the Nextera kit (Illumina). Resulting libraries were purified on AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 5’ CGT ACA GCG GCT TGT TGG CTG TGA, and fA23M, 5’ GCG CTC CAG CTC CTT CTG CCC ATA, primers to which the Illumina sequencing primer sequences were attached to their 5’ ends) ...
-
bioRxiv - Microbiology 2022Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110-3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Cancer Biology 2022Quote: ... using primers DCF01 5’-CTTGTGGAAAGGACGAAACACCG-3’ and DCR03 5’-CCTAGGAACAGCGGTTTAAAAAAGC-3’ and subjected to single-end 75 bp (SE75) high-throughput sequencing using a NextSeq550 (Illumina).
-
bioRxiv - Immunology 2020Quote: ... Use of 250 pg of cDNA with 1/5 reaction of Illumina Nextera XT kit (Illumina, San Diego, CA, USA). The length distribution of the cDNA libraries was monitored using DNA High Sensitivity Reagent Kit on the Perkin Elmer Labchip GX system (PerkinElmer ...
-
bioRxiv - Immunology 2020Quote: ... The enriched B cell libraries were sequenced in NextSeq or MiSeq sequencer using NextSeq Mid Output v2.5 sequencing reagent kit (read length: 2 × 150 bp) or MiSeq Reagent Kit v2 (read length: 2 × 150 bp) (Illumina) respectively.
-
bioRxiv - Cancer Biology 2020Quote: Genomic DNA from 28 samples in which scDNA-seq data showed at least 5% of homozygously mutated clones were analyzed by Illumina Omni2.5-8 SNP array ...
-
bioRxiv - Developmental Biology 2020Quote: ... and two different mate-pair libraries (3 kb and 5 kb) were prepared with a Nextera Mate Pair Library Prep Kit (Illumina). Sequencing libraries were run on the Illumina Hiseq 2500 sequencer with a read length of 150 bp ...
-
bioRxiv - Molecular Biology 2020Quote: ... nuclei were isolated from 100,000 cells and sequencing adapters were transposed for 30 minutes at 37°C using 5 μl of TDE1 (Nextera Tn5 transposase, Illumina). After PCR and gel purification ...
-
bioRxiv - Genomics 2021Quote: ... The samples were amplified for 5-8 cycles as determined by qPCR for Illumina sequencing using Nextera library preparation kit (Illumina) and samples were paired-end sequenced on HiSeq4000 ...