Labshake search
Citations for Illumina :
301 - 350 of 369 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... Micro-C libraries (at least 3 per each biological replicate) that passed QC criteria were pooled and paired-end sequenced on a NovaSeq6000 platform (Illumina) to >600 million read pairs per replicate ...
-
bioRxiv - Microbiology 2023Quote: ... The transposon-specific primer was designed to include (from 5’ to 3’): (i) the “P5” or “P7” flow-cell annealing sequence (Illumina), (ii ...
-
bioRxiv - Genomics 2024Quote: All samples were processed using the 10x Genomics Chromium 3’ Single Cell Protocol and sequenced using NovaSeq 6000 S1 (Illumina). For the first sample containing NSC pools 1.1 and 1.2 ...
-
bioRxiv - Immunology 2024Quote: Bulk RNA-Seq: Libraries were generated using a QuantSeq 3’ mRNA-Seq Library Prep Kit (Lexogen) and sequenced using a NovaSeq (Illumina). After adaptor trimming ...
-
bioRxiv - Cell Biology 2024Quote: ... The library preparation and RNA sequencing was performed by Birmingham Genomic centre using Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD from Illumina. Libraries were quantified using a PicoGreen Quant-iT kit and sized with a D1000 tape ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA was dephosphorylated in 3’ and then phosphorylated in 5’ to generate cDNA libraries using the NebNext Small RNA Sample Prep kit with 3’ sRNA Adapter (Illumina) according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB) ...
-
bioRxiv - Neuroscience 2024Quote: ... Single nuclei were isolated from frozen brain tissue using iodixanol-based density gradient centrifugation and submitted to UCLA Technology Center for Genomics and Bioinformatics for library preparation (via Chromium Single Cell 3’ v3 kit from 10x Genomics) and sequencing (via NovaSeq 6000 S2 platform from Illumina). Cell Ranger (10x Genomics ...
-
bioRxiv - Immunology 2024Quote: ... Single-cell RNA libraries were prepared according to the 10x Genomics Chromium Single Cell 3′ Reagent Kits v2 User Guide and sequenced (paired-end) on a HiSeq 4000 (Illumina).
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide containing the Illumina P7 adaptor sequence was ligated to the 3’ end of the single stranded LAM PCR fragments using Circligase (Epicentre/Illumina, #CL9025K). A P5 adaptor was added by PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries (1.3 nM) were chemically denatured and applied to an Illumina NovaSeq flow cell using the NovaSeq XP chemistry workflow (Illumina-20021664). Following transfer of the flowcell to an Illumina NovaSeq instrument ...
-
bioRxiv - Neuroscience 2020Quote: ... The cell solutions were immediately transferred to ice and transported to the Wellcome Trust Centre for Human Genetics (WTCHG) for scRNAseq via 10x genomics chromium (10x genomics, US) (Single Cell 3’ v3) and Illumina hiseq 4000 (Illumina, US). This approach achieved 66-72K mean reads per cell and a sequencing depth of 53-55% per cell before filtering.
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was extracted and sequence reads (100 bp paired-end) were generated with Illumina TruSeq high output version 3 chemistry on a HiSeq 2500 (Illumina, Inc.) at NRC-Plant Biotechnology Institute (NRC-PBI) ...
-
bioRxiv - Cancer Biology 2020Quote: ... TN5 tagmentation and library amplification realized 3’end fragments by Nextera XT DNA Sample Preparation Kit (Illumina, Cat#FC-131-1024) according to the manufacturer’s instructions while P5_TSO and Nextera_N7xx took the place of the custom primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... 500 ng of total RNA were used as input for QuantSeq (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina; Lexogen) following the autoQuantSeq automated workflow ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were processed according to the standard 10x Chromium 3’ workflow and pooled before sequencing over two lanes (Illumina HiSeq 4000).
-
bioRxiv - Genomics 2019Quote: ... The resulting libraries always contain dual-indexes in the standard indexing positions and may optionally contain additional internal indexes (Figs. 1–3; Table 1; Illumina, 2018b). These indexes are recovered through the four standard separate sequencing reactions generated by Illumina instruments when doing paired-end sequencing (Fig ...
-
bioRxiv - Cancer Biology 2019Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters from TruSeq™ Stranded Total RNA Sample Preparation Kit with Ribo-Zero Gold (Illumina) were ligated.
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng alkylated RNA was used and prepared with a commercially available kit (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina, Lexogen). Sequencing was performed on an Illumina NovaSeq SP platform in 100bp-single-read mode.
-
bioRxiv - Genomics 2021Quote: ... and ligated to custom CpG-free annealed adapters (Oligo 3 - Custom CpG-free P7 adapter and Oligo 4 - Custom CpG-free P5 adapter; annealed according to the standard Illumina protocol). The adapter-ligated gDNA was purified and amplified in 20 reactions using KAPA HiFi master mix (Roche ...
-
bioRxiv - Genomics 2021Quote: ... and 1µM Dexamethasone or 0.1% ethanol for 3 hours. Transposition was performed using the OmniATAC protocol (Corces et al. 2017) and the tagment DNA TDE1 enzyme (Illumina, 20034197). DNA was purified using the MinElute PCR purification kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: The input samples were submitted to the Washington University Genome Technology Access Center to obtain and sequence the cDNA libraries (10XGenomics, 3’v3.1; Illumina NovaSeq S4) according to established protocols ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Then the scRNA-seq libraries were constructed by using the Chromium Next GEM Single Cell 3’ Reagent Kits v3 (10X Genomics, USA) and sequenced by using the sequencer Novaseq6000 (Illumina, USA). All procedures were following the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2023Quote: ... 1 x 105 mESCs and 5 x 104 S2 cells were resuspended in Tagment DNA Buffer and treated with 3 µL TDE1 Tagment DNA Enzyme (Illumina 20034197). After thorough mixing ...
-
bioRxiv - Genomics 2023Quote: For all tandem repeat identification and quantification we used DNA sequences from 2,504 individuals from the Phase 3 of the 1,000 Genomes Project (∼30x coverage Illumina short-read data) (Byrska-Bishop et al ...
-
bioRxiv - Immunology 2024Quote: ... 2024) using the command CreateSeuratObject with the following parameters: min.cells = 3 and either min.features = 200 (for Illumina reads from MBC gate) or min.features = 100 (for the Oxford Nanopore reads from the ASC gate) ...
-
bioRxiv - Genomics 2023Quote: ... 200ng alkylated RNA were used as input for generating 3’-end mRNA sequencing libraries using a commercially available kit (QuantSeq 3ʹ mRNA-Seq Library Prep Kit FWD for Illumina, Lexogen).
-
bioRxiv - Evolutionary Biology 2021Quote: ... we combined 3 μl of each sample (approx 2.24 ng) with a small quantity of a Nextera™ tagment DNA enzyme (Illumina catalogue #15027865). To decrease costs ...
-
bioRxiv - Microbiology 2021Quote: ... The libraries were sequenced using an Illumina MiSeq with MiSeq Reagent Kit v.3 (2x 300 bp, Illumina, San Diego, CA, USA) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... The quantitative 3-step real-time PCR was performed by the Eco Real-Time PCR system (Illumina Inc., San Diego CA, USA) and CFX Connect (Bio-Rad Laboratories AG ...
-
bioRxiv - Genetics 2019Quote: ... with the European individuals from the 1000G phase 3 reference panel and from the Human Genome Diversity Panel data30 (HGDP, Illumina HuHap 650k), to generate four genome-wide SNP datasets analyzed independently.
-
bioRxiv - Immunology 2019Quote: Single-cell RNA-sequencing libraries were generated using the 10x Genomics Single Cell 3’ Solution (version 2) kit and sequenced to an average depth of > 200k reads/cell (Illumina HiSeq 4000). Data analysis was performed using Python3 pipelines (https://github.com/sansomlab/tenx ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA-seq libraries were constructed using a QuantSeq 3’mRNA-Seq Library Prep Kit (LEXOGEN, Vienna, Austria) and sequenced with the NextSeq500 (Illumina, CA, USA) to generate a minimum of two million single-end 75-bp reads ...
-
bioRxiv - Genomics 2021Quote: ... and Reverse primer (5’-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA GGA CTA CHV GGG TAT CTA ATC C-3’) with Illumina sequencing adaptors (Illumina, California, USA). The purified PCR products were then subjected to a multiplexing process using Nextera XT Index kit (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... all of the ChIP DNA and 220 ng of input DNA were mixed with 3 units of T4 DNA polymerase (NEBNext® DNA Library Prep Master Mix Set for Illumina, #E6040L) to create blunt ends ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD for Illumina and UMI Second Strand Synthesis Module for QuantSeq FWD (Illumina, Read 1) from Lexogen (015.96 and 081.96 ...
-
bioRxiv - Genomics 2023Quote: ... WGS of the samples of Batch 3 was commercially performed by Eurofins (Germany) using Genome Sequencer Illumina NovaSeq platform (Illumina, California, USA) (paired-end 150 bp reads).
-
bioRxiv - Synthetic Biology 2024Quote: ... and a reverse primer annealing to the intronic region directly 3’ of the J segment (PCR1 Rev primer with Illumina adapter overhang). PCRs were performed with Q5 High-fidelity DNA polymerase (NEB ...
-
bioRxiv - Developmental Biology 2024Quote: ... Single cell libraries were prepared by the University of Michigan Advanced Genomics Core and sequencing was performed using the 10X Genomics Chromium platform using manufacturer’s protocol for 10x Single Cell Expression 3’ and sequenced on the NovaSeq (S4) 300 cycle (Illumina, San Diego, CA). Sequencing outputs were demultiplexed using 10x Genomics Cell Ranger 7.1.0 software and FASTQ files were aligned to the Genome Reference Consortium Mouse Build 38 ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA-seq libraries were generated using Illumina SureCell WTA 3’ Library Prep Kit for the ddSEQ System (6 cartridge version, cat.no. 20014280, Illumina, San Diego, CA, USA). Libraries were assessed for quality ...
-
bioRxiv - Genomics 2020Quote: ... and libraries were constructed by the Lexogen QuantSeq 3’ mRNA-Seq Library Kit FWD (Lexogen, Vienna, Austria).19 All RNA libraries were sequenced by the Illumina HiSeq4000 (Illumina, San Diego, CA). Raw sequencing data were aligned to the reference genome (GRCh37 ...
-
bioRxiv - Developmental Biology 2019Quote: The BRB-seq is a technique for multiplexed RNA-seq16 which is able to provide high-quality 3’ transcriptomic data at a low cost (e.g. 10-fold lower than Illumina Truseq Stranded mRNA-seq). The data (fastq files ...
-
bioRxiv - Genetics 2021Quote: ... Libraries constructed with the Lexogen QuantSeq 3′ mRNA-Seq Library Kit FWD (Lexogen, Greenland, NH) were sequenced on an Illumina NextSeq 500 (Illumina, San Diego, CA) at the Genomics Facility of the Cornell Institute of Biotechnology.
-
bioRxiv - Evolutionary Biology 2021Quote: ... All three reactions were pooled in equal-molar ratios and sequenced (paired end 300 bp) on one lane of Illumina MiSeq version 3 chemistry (Illumina, San Diego, California). The final reaction comprising 21 libraries with DNA concentrations 11.4 – 20.0 ng/μl was performed and sequenced as above.
-
bioRxiv - Systems Biology 2021Quote: Single nuclear 3’ RNA-sequencing was performed at the Indiana University Center for Medical Genomics Core using the Chromium single cell system version 3 (10x Genomics, San Francisco, CA) and the NovaSeq6000 sequencer (Illumina, San Diego, CA). Cell Ranger 4.0 was utilized to generate sample-specific FASTQ files and reads were aligned to the mm10 reference genome using STAR ...
-
bioRxiv - Microbiology 2021Quote: ... Goe13 and lysogens and sequenced with the MiSeq system and reagent kit V.3 (2 x 300 bp) (Illumina, San Diego, CA, USA) and the NovaSeq system (2x 150bp ...
-
bioRxiv - Molecular Biology 2022Quote: ... The forward primers were 5’-CAA GCA GAA GAC GGC ATA CGA GAT XXX XXX GTG ACT GGA GTT CCT TGG CAC CCG AGA ATT CCA-3’ (in which XXX XXX represents Illumina’s indexing hexanucleotide sequences), and the reverse primer was 5’-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACG TTC AGA GTT CTA CAG TCC GA-3’ ...
-
bioRxiv - Neuroscience 2021Quote: ... and a reverse primer 5′-GGA GTT CAG ACG TGT GCT CTT CCG ATC TTA CCA GGG TAT CTA ATC CT-3′ (28-nt Illumina adapter (in bold) followed by the 19 nt broad range bacterial primer 784R) ...