Labshake search
Citations for Illumina :
1 - 50 of 369 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: RNA from a subset of human fetal (n = 3) and mouse (n = 8) cortex tissue samples was prepared with TruSeq Stranded mRNA Sample Prep Kit (Illumina) and subjected to 125bp paired-end sequencing using a HiSeq2500 (Illumina) ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Immunology 2024Quote: ... RNAseq data of 4 databases covering 66 healthy tissues (Uhlen: n=122 individuals, n=32 tissues65; GTEx: n=1,315 individuals, n=53 tissues66; Illumina body map ...
-
bioRxiv - Cancer Biology 2020Quote: The RNA-seq libraries (n=3 per experimental group) were prepared using the NEBNext Ultra II RNA library prep kit from Illumina (New England Biolabs Inc. ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA-seq libraries for yeast (n = 3 per tested condition) and neuroblastoma cells (n = 3 per tested condition) were prepared according to the TruSeq stranded mRNA protocol (Illumina) and 101-bp single-end reads produced on an Illumina NovaSeq 6000 instrument ...
-
bioRxiv - Microbiology 2020Quote: ... Shotgun metagenomic libraries were then constructed from a subset of these animals (LDC N = 15, DDC N = 7, CZMD N = 7) using the Nextera XT kit (Illumina, San Diego, CA USA) and sequenced on and Illumina HiSeq 3000 using a 150bp PE sequencing kit (Illumina).
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct, n=6; Illumina TruSeq RNA Exome, n=5) was sequenced on one lane on the Illumina HiSeq 3000 platform in the Technology Center for Genomics and Bioinformatics at UCLA ...
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...
-
bioRxiv - Genomics 2023Quote: ... RNA was extracted from similar pooled-samples (N = 3) using the ZYMO (Irvine, CA, USA) direct-zol miniprep kit (Cat. # R2050) and sequenced using NovaSeq (Illumina, San Diego, CA, USA) paired-end (150 bp ...
-
bioRxiv - Genetics 2019Quote: Genotype information was available for 21,001 NTR participants from 6 different genotyping arrays (Affymetrix 6.0 [N = 8,640], Perlegen-Affymetrix [N = 1,238], Illumina Human Quad Bead 660 [N = 1,439] ...
-
bioRxiv - Microbiology 2020Quote: ... water (n=9) and sediment (n=9) samples were subjected to bacterial 16S rRNA amplicon profiling by Illumina sequencing ...
-
bioRxiv - Genomics 2023Quote: ... Both low density 15k SNP chip (SheepLD; n=2,956) and medium density 50k SNP chip (Ovine SNP50 BeadChip; n=3,889) were purchased from Illumina Inc ...
-
bioRxiv - Microbiology 2023Quote: Raw data generated from Illumina (n=22) and PacBio (n=2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10%(v/v) N,N-dimethyl formamide) and 1 μl of Tagment DNA Enzyme from Nextera Sample Preparation Kit (Illumina) were added to the DNA-beads complex and incubated for 70 sec at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... we used one batch of 20 ng of total photoreceptor (n = 8) RNA and 30 ng for the other three batches (n = 24) according to the manufacturer’s protocol (Illumina Platforms). For generating libraries from RPE samples we used 20 ng of RNA ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Each clone (n=22) was sequenced by Illumina with 150pb paired-end reads ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Each clone (n=15) was sequenced by Illumina with 150pb paired-end reads ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... a selection of 288 Enterobacterales recovered from water (n=155) and wastewater (n=133) samples underwent paired-end short read sequencing using Illumina (Illumina, USA) NovaSeq 6000 or MiSeq platforms ...
-
bioRxiv - Genomics 2020Quote: ... using 5% PhiX without dark cycles (n = 11) or 10-20% PhiX with 7 dark cycles (protocol provided by Illumina, n = 49). A maximum of 12 samples were pooled in one sequencing run resulting in 19.05 million [17.05 – 21.72] single-end reads per sample on average (supplementary table 3).
-
bioRxiv - Cancer Biology 2019Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Neuroscience 2021Quote: ... We used TruSeq Stranded mRNA kits (Illumina P/N 20020594) to prepare the stranded mRNA libraries ...
-
bioRxiv - Developmental Biology 2022Quote: ... PhiX Control v3 adapter-ligated library (Illumina p/n FC110-3001) was spiked-in at 1% by weight to ensure balanced diversity and to monitor clustering and sequencing performance ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Neuroscience 2020Quote: ... The TruSeq RNA Sample Preparation Kit (Illumina, Cat. N°RS-122-2002, USA) was used for library preparation (1 µg total RNA) ...
-
bioRxiv - Genetics 2020Quote: ... bovis (n=84 genotyped animals retained after quality control of the Illumina reads). Controls were animals which were lesion and culture negative for M ...
-
bioRxiv - Genetics 2020Quote: ... bovis (n=128 genotyped animals retained after quality control of the Illumina reads). An additional Fulani animal was also genotyped but we did not have any information on its M ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... the two libraries then were pooled with 48 libraries of other projects and subsequently sequenced on 0.09% (L. virgatum) and 0.08% (L. vulgare) of one lane on an Illumina MiSeq system (Illumina, San Diego, California, USA) at the Department of Biochemistry I at the University of Regensburg ...
-
bioRxiv - Plant Biology 2023Quote: ... The nuclei pellet was then immediately resuspended in 25 μ L of 2x tagmentation buffer containing 2 μ L of TDE1 (Illumina). The reaction was placed at 37C for 30 minutes with gentle mixing three times ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2024Quote: ... and an independent validation set (3 Illumina HumanMethylation450K array studies ...
-
bioRxiv - Genomics 2024Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Genomics 2022Quote: Multi-omics data utilized in JHS analyses including methylomics (n = 1,750, Illumina MethylationEPIC BeadChip array) [40] and proteomics (n = 2,144 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and quantified using qPCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824) as previously described (Couturier et al ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...