Labshake search
Citations for Illumina :
51 - 100 of 369 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2024Quote: ... 16S rRNA PCR amplification and next-generation sequencing were performed at MR DNA (www.mrdnalab.com) using primers 515F-Y (5’-GTGCCAGCMGCCGCGGTAA-3’)73 and 806R (5’-GGACTACHVGGTWTCTAAT-3’)74 using Illumina MiSeq (Illumina Corp) 2x300 paired- end reads ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10% (vol/vol) dimethylformamide) and 2.5 ?l of TDE1 enzyme (Illumina). Transposed fragments were purified using a MinElute PCR purification kit (QIAGEN) ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
bioRxiv - Genomics 2019Quote: ... to generate ~3 GB data (Illumina, Inc, USA). The total yield of the Number of Paired end was 26,263,128 with the maximum data of 3.78 GB ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Genomics 2024Quote: ... and alternating reverse oligos (3’ P7 Illumina adapter). The demulitplexing primers used for PCR2 are listed in Extended Data Table 4 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 300pM of the pooled library was loaded onto a NovaSeq S1 flowcell (Illumina p/n 20012865), using the Standard Workflow loading conditions designated by the manufacturer and amplified by exclusion amplification (ExAMP ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA primers TS Primer-X (“X” stands for barcode index; CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAG AATTCCA, N=standard Illumina barcodes) and TS Primer-1 (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Molecular Biology 2023Quote: ... and each sample was sequenced in 3 different lanes (3 technical replicates per sample) on an Illumina HiSeq platform (Illumina, USA).
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Microbiology 2019Quote: ... denatured with 0.1 N NaOH and after dilution loaded in a MiSeq Reagent kit V2-500 (Illumina) at 8 pM concentration ...
-
bioRxiv - Cell Biology 2019Quote: ... the libraries were sequenced in multiplex (n=2 per sequencing run) on the NextSeq 500 sequencer (Illumina) to produce between 200 and 250 million reads per library and on average a minimum of 30,000 reads per single-cell.
-
bioRxiv - Cell Biology 2020Quote: ... The libraries were sequenced in multiplex (n=2 per sequencing run) on the NextSeq 500 sequencer (Illumina) to produce between 200 and 250 million reads per library.
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 2017 (n = 11) were prepared into two Illumina TruSeq LT libraries (Illumina, Inc. San Diego, CA), and sequenced on two Illumina NextSeq500 runs.
-
bioRxiv - Neuroscience 2021Quote: ... using TruSeq SR Cluster Kit 3-cBot-HS (Illumina) and TruSeq SBS Kit 3-HS (Illumina ...
-
bioRxiv - Immunology 2024Quote: ... 3 biological replicates were sequenced with NextsSeq 550 (Illumina). For data analysis ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Developmental Biology 2024Quote: ... library construction was immediately carried out using a Chromium Single Cell 3’ Reagent Kit (Version 3) and sequenced on an Illumina HiSeq 4000 or an Illumina NextSeq2000 (Illumina, cat no. 20040559) by the Technion Medicine Faculty Azrieli-Technion Genomics Center ...
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Genomics 2020Quote: ... All other bulls (N = 3679) were genotyped at approximately 50,000 SNPs using medium density (MD) chips (e.g., the Illumina BovineSNP50 bead chip that comprises 54,001 (version 1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNAseq-based gene expression and methylation array data (either Illumina human methylation27K array, n = 15 genomes; or Illumina human methylation450K array ...
-
bioRxiv - Physiology 2020Quote: Sequencing libraries (n=167) were prepared with the TruSeq Stranded mRNA HS kit (Illumina, San Diego, California, USA). The 2100 Bioanalyzer using the DNA 1000 kit (Agilent Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... and the primers V3F - 5’-CCTACGGGNGGCWGCAG-3’ and V4R – 5’-GACTACHVGGGTATCTAATCC-3’ [28] with the addition of the appropriate Illumina Nextera XT overhang adapter sequences (Illumina, San Diego, CA, USA). Following purification using a magnetic bead capture kit (Ampure ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3’ end adenylation per the TruSeq protocol (Illumina, Inc.), libraries were constructed using an Apollo 324 automated library system ...
-
bioRxiv - Molecular Biology 2019Quote: ... v1.5 small RNA 3’ adaptor kit (Illumina FC-102-1009) or by using TruSeq directional small RNA kit (Illumina RS-200-0012) ...
-
bioRxiv - Genomics 2019Quote: ... the sequence 3’ of the indices were bound by Illumina’s Sequencing Primers ...
-
bioRxiv - Plant Biology 2023Quote: ... with the MiSeq reagent kit version 3 (600 cycles; Illumina). The reads were cleaned up using the cutadapt ver ...
-
bioRxiv - Cell Biology 2019Quote: ... The sequencing libraries were quantified by quantitative PCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824) and Qubit 3.0 with dsDNA HS Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... 30 libraries (n=15 for each group) were constructed using the HiSeq Library Preparation kit (Illumina, San Diego, USA) and sequenced using Illumina NovaSeq™ ...
-
bioRxiv - Cancer Biology 2022Quote: mRNA libraries of the mouse melanoma tumor (n = 12) samples were prepared and sequenced using the HiSeq 2000 (Illumina). RNAseq data were processed by pyflow-RNAseq (Tang ...
-
bioRxiv - Immunology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Microbiology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Cancer Biology 2023Quote: ... All samples were pooled equimolarly and sequenced on a NextSeq 500 High Output v2.5 flowcell (Illumina p/n 20024906) using the Illumina NextSeq 500 sequencing instrument with a single-read configuration (75 bp) ...
-
bioRxiv - Zoology 2023Quote: ... construction using the ONT rapid barcoding kit (SQK-RBK004 or SQK-RBK110.96) or an Illumina MiSeq (n=257) using the Nextera XT Library Preparation kit (Illumina) following the manufacturers’ protocol ...
-
bioRxiv - Immunology 2023Quote: ... dual-indexed 3’ DGE libraries were prepared using Nextera XT (Illumina) and sequenced to depth on the NovaseqS4 platform with a paired-end read structure (R1 ...
-
bioRxiv - Immunology 2023Quote: ... Sequencing was performed in 3 sequencing unit of NovaSeq 6000 (Illumina) (100-nt-length reads ...
-
bioRxiv - Immunology 2023Quote: The 3’ adapters were ligated according to the TruSeq kit (Illumina) manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lexogen’s QuantSeq 3’mRNA-seq Library Prep Kit (FWD for Illumina) was utilized for building RNA-seq libraries from 0.1-200 ng of total RNA in 5 µl of nuclease-free ultrapure water ...
-
bioRxiv - Developmental Biology 2022Quote: ... The barcode sequencing libraries were quantified by quantitative PCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824). Sequencing libraries were loaded at 18 pM on an Illumina HiSeq2500 using the following read length ...
-
bioRxiv - Molecular Biology 2019Quote: ... or conventional short read RNA-seq of fragmented cDNAs at 20 million (T) or 100 million (N) read depth (Illumina). Full length RNA-seq data were processed using the ToFU platform ...
-
bioRxiv - Genomics 2020Quote: ... The normalised samples (4 nM) were denatured with 0.2 N NaOH and diluted 20 pM using pre-chilled Hybridisation Buffer (HT1) (Illumina, USA). The 20 pM transcriptome libraries were further diluted to 10 pM with pre-chilled HT1 buffer prior to whole transcriptome sequencing on a MiSeq platform.
-
bioRxiv - Cancer Biology 2020Quote: Capture-based next-generation DNA sequencing for cases with sufficient material (n=18) was performed on a NextSeq 500 instrument (Illumina) as previously described13 using a custom brain tumor panel covering the entire coding and selected intronic and promoter regions of 130 or 160 genes of particular relevance in central nervous system tumors ...
-
bioRxiv - Cancer Biology 2022Quote: All 450K array methylation level files were downloaded (Data Type: “Methylation beta value”, Platform: “Illumina Human Methylation 450”; n = 507). The average CpG methylation level over DMRs identified in this study and GENCODE transcript promoters was calculated in all TCGA LUAD and matched normal samples ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from 500 µl of O/N cultures using the Epicentre MasterPureTM DNA purification kit (Illumina Inc.) according to the manufacturer’s instructions ...