Labshake search
Citations for Illumina :
301 - 350 of 9158 citations for Cortisol ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... 5 mM MgCl2) containing 1 μl Tn5 transposase from the Nextera DNA Library Prep Kit (15028212, Illumina, San Diego, USA) and incubated at 37°C for 10min ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The ~2 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina) as previously described [79] ...
-
bioRxiv - Developmental Biology 2020Quote: ... and two different mate-pair libraries (3 kb and 5 kb) were prepared with a Nextera Mate Pair Library Prep Kit (Illumina). Sequencing libraries were run on the Illumina Hiseq 2500 sequencer with a read length of 150 bp ...
-
bioRxiv - Genomics 2021Quote: ... The samples were amplified for 5-8 cycles as determined by qPCR for Illumina sequencing using Nextera library preparation kit (Illumina) and samples were paired-end sequenced on HiSeq4000 ...
-
bioRxiv - Physiology 2021Quote: ... Single-indexed strand-specific cDNA library from total RNA samples (500 ng input with RIN ≥ 5) was prepared using TruSeq Stranded mRNA Library Prep Kit (Illumina) as per directions by the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... 1.5 μg of purified RNA for each sample was processed using the Ribozero rRNA Removal Kit (Gram-negative bacteria) (Illumina) according to the manufacturer’s instructions except that reaction volumes were reduced by 50% ...
-
bioRxiv - Genetics 2021Quote: ... and ribosomal RNA was depleted from 5 ug of total RNA using the Ribo-Zero™ Gold Kit (Illumina, Inc.). Depleted mRNA was fragmented and converted to first strand cDNA ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... The rRNA-depleted samples were used for TruSeq Stranded RNA Sample Prep kit to produce 5′ to 3′ strand-specific cDNA libraries (Illumina). A TruSeq SBS sequencing kit version 3 (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... Ribosomal RNA (rRNA) was then depleted from each sample (5 µg each) using the bacterial Ribo-Zero rRNA Removal Kit (Illumina). The integrity of the RNA was evaluated using an RNA 6000 Nano LabChip and an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Immunology 2020Quote: ... 0.3 to 0.5 ng of pre-amplified cDNA was used to generate barcoded Illumina sequencing libraries (Nextera XT library preparation kit, Illumina) in an 8μL reaction volume ...
-
bioRxiv - Genomics 2021Quote: ... The 20 ul preamp was then mixed with 25 ul TD buffer and 5 ul TDE1 buffer (Nextera kit, FC-131-1096, Illumina) and incubated for 5 min at 55 C and held at 10 C ...
-
bioRxiv - Microbiology 2022Quote: ... Ribosomal RNA (rRNA) was subsequently depleted from each RNA sample (5 µg each) using the bacterial Ribo-Zero rRNA Removal Kit (Illumina). The integrity of the RNA was evaluated using an RNA 6000 Nano LabChip and an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... A 2.5 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced at the Broad Institute Genomics Platform on an Illumina HiSeq 2000 system to generate paired 101-base reads ...
-
bioRxiv - Microbiology 2023Quote: ... 3-5 µg of each sample was treated with Ribozero® rRNA Removal Kit according to the manufacturer’s instructions (Illumina, USA ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was dephosphorylated in 3’ and then phosphorylated in 5’ to generate cDNA libraries using the NebNext Small RNA Sample Prep kit with 3’ sRNA Adapter (Illumina) according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB) ...
-
bioRxiv - Genomics 2022Quote: Small RNA libraries were prepared starting from 5 µL RNA eluate using the TruSeq Small RNA Library Prep Kit (Illumina, RS-200-0012 ...
-
bioRxiv - Cancer Biology 2023Quote: RNA-seq libraries were prepared with 0,5-1 µg of total high quality RNA collected from samples and the Illumina Stranded Total RNA Prep kit (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Illumina sequencing libraries were indexed with unique 5’ and 3’ barcode combinations (up to 384 cells) using the Nextera XT DNA library preparation kit (Illumina). Libraries were pooled and size-selected with 0.9X AmpPure XP beads ...
-
bioRxiv - Genomics 2024Quote: ... A 2.5-kb ‘jumping’ library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced on an Illumina HiSeq 2000 ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Genetics 2021Quote: ... RADseq libraries and whole genome libraries were prepared and sequenced on the HiSeq 3000 or NovaSeq S2 sequencing system (Illumina). RADseq sequencing data were analyzed as described in the linkage map section ...
-
bioRxiv - Genomics 2020Quote: Whole-genome shotgun sequencing of the DNA extracts was performed on the Illumina NextSeq 500 instrument (Illumina, San Diego, CA) using a modified Illumina Nextera library preparation protocol as described previously [30] ...
-
bioRxiv - Molecular Biology 2019Quote: ... Those strains were chosen in order to genotypically match NSTI strains on the basis of micro-array-deduced clonal complexes (23) confirmed by whole genome sequencing (Illumina MiSeq technology ...
-
bioRxiv - Molecular Biology 2019Quote: ... Those strains were chosen in order to genotypically match NSTI strains on the basis of micro-array-deduced clonal complexes (23) confirmed by whole genome sequencing (Illumina MiSeq technology, Illumina, San Diego ...
-
bioRxiv - Microbiology 2021Quote: ... Whole-genome sequencing (WGS) using a multiplex sequencing approach was performed on an Illumina Miseq genome sequencer (Illumina, Cambridge UK) using Nextera XT libraries and third generation MiSeq reagent kits ...
-
bioRxiv - Neuroscience 2020Quote: ... Bulk DNA samples and single neuronal nuclei amplified by multiple displacement amplification (MDA) were prepared and whole-genome sequenced by Illumina HiSeq platforms as part of previous studies in our lab (16) ...
-
bioRxiv - Genomics 2019Quote: A set of 196 strains was subjected to whole genome shotgun sequencing using 2×250 bp Illumina (Illumina, Inc., USA) paired-end reads by MicrobesNG (https://microbesng.uk/ ...
-
bioRxiv - Microbiology 2020Quote: ... The pO157-cured and WT strains were whole genome sequenced from a paired-end library to generate short-read (Illumina) sequences (ENA accessible number ...
-
bioRxiv - Microbiology 2021Quote: ... 2008 [60] and the whole genomes sequenced on the HiSeq2000 according to the manufacturer’s instructions (Illumina, San Diego, CA, USA) at the Welcome Trust Sanger Institute ...
-
bioRxiv - Genomics 2019Quote: ... A whole genome library was created from strain CAI4-F2-Neut5L-NAT1-mCherry-GFP using Nextera-XT library construction strategy(Illumina) and sequenced on an Illumina MiSeq (150×150 paired end sequencing ...
-
bioRxiv - Evolutionary Biology 2019Quote: We used whole genome amplification of single miracidia dried on FTA cards followed by exome capture and sequencing (Illumina 2500) to generate genome-wide sequence data following methods described in Le Clec’h et al ((Le Clec’h ...
-
bioRxiv - Genetics 2021Quote: ... and ultra-deep whole genome sequencing (average 30X read-depth across the genome) was performed on a HiSeq X Ten System (Illumina). We developed an efficient data processing and quality control pipeline ...
-
bioRxiv - Genetics 2021Quote: ... high-throughput exome sequencing was performed on a whole-exome library created from Tvrm266 genomic DNA on a HiSeq 2000 Sequencing System (Illumina) as previously described [98] ...
-
bioRxiv - Neuroscience 2020Quote: ... and ultra-deep whole genome sequencing (average 30X read-depth across the genome) was performed on a HiSeq X Ten System (Illumina). We developed an efficient data processing and quality control pipeline ...
-
bioRxiv - Cancer Biology 2022Quote: ... whole-genome and targeted libraries were added to flow cell in a 67%-33% ratio and sequenced to approximately 16M fragments per sample corresponding to ~1-2x whole genome coverage using NovaSeq S4 sequencing (Illumina) with 150 bp paired-end reads.
-
bioRxiv - Microbiology 2022Quote: ... was combined with short-read whole-genome sequencing data for the 169 individuals (2×125 bp or 2×150 bp Illumina paired-end sequencing ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... Arrays were washed and scanned following the protocols in the Illumina Whole-Genome Gene Expression Direct Hybridization Assay Guide (Illumina). Signal data were extracted from the image files with the Gene Expression module of the GenomeStudio software (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... was used to prepare a whole-transcriptome sequencing library and sequenced on one lane of a NovaSeq 6000 SP (Illumina) machine.
-
bioRxiv - Cancer Biology 2023Quote: ... library preparation was performed using a modified single cell whole genome sequencing protocol and 77 base pair single reads were generated using a NextSeq 500 sequencing instrument (Illumina). From each assessed tumour ...
-
bioRxiv - Plant Biology 2023Quote: ... together with a wild type (WT) plant were whole genome sequenced with an Illumina sequencer (Illumina Inc., San Diego, USA). One μg of DNA was used to prepare short insert (length 350 bp ...
-
bioRxiv - Cancer Biology 2024Quote: ... library preparation was performed using a modified single-cell whole-genome sequencing protocol and 77 base pair single reads were generated using a NextSeq 500 sequencing instrument (Illumina). From each assessed case ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Immunology 2021Quote: ... 1.5 ng cDNA was tagmented using 0.5 μl TruePrep Tagment Enzyme V50 and 1x TruePrep Tagment Buffer L (TruePrep DNA Library Prep Kit V2 for Illumina, Vazyme), followed by an incubation step at 55 °C for 10 min ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Purified PCR products were given unique dual indexes at the 5’ end using the Nextera XT Index Kit v2 index primers (Illumina, USA). To attach the index primers ...
-
bioRxiv - Immunology 2020Quote: ... Supernatant was discarded and nuclei were re-suspended in 50 μl reaction buffer containing 5.0 μl Tn5 transposase and 10 μl of 5 × TTBL buffer (TruePrepTM DNA Library Prep Kit V2 for Illumina, Vazyme Biotech). The reaction was incubated at 37°C for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... Samples were concentrated using a centrifugal evaporator Speed Vac® to a final volume of 5 μl and we started the TruSeq Small RNA Sample Preparation Kit (Illumina) protocol according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: Sequencing libraries were prepared from 100 ng DNA using the TruSeq Nano DNA sample preparation kit (cat# 20015964/5, Illumina Inc.) targeting an insert size of 350bp ...