Labshake search
Citations for Illumina :
201 - 250 of 9158 citations for Cortisol ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Whole genome sequencing variant calling was performed using paired-end reads generated by Illumina sequencing (2 x 150 bp) ...
-
bioRxiv - Molecular Biology 2023Quote: ... lower coverage whole genome sequencing (“genome skimming”) using the next-generation sequencing by Illumina NovoSeq-5500 platform was used to obtain the missing genes ...
-
bioRxiv - Microbiology 2023Quote: ... Transposon mutant 19_H4 was sent for whole genome sequencing (Illumina; 2 X 151 bp) to identify the insertion site of the transposon.
-
bioRxiv - Evolutionary Biology 2023Quote: ... the whole genome sequencing was performed using the Illumina COVIDSeq protocol (Illumina Inc, USA) on Illumina sequencing platform ...
-
bioRxiv - Genomics 2023Quote: ... We generated >25x coverage whole-genome short-read paired-end data (using Illumina Novaseq) for all 13 individuals sampled (see Table S1).
-
Juxtacrine DLL4-NOTCH1 signaling between astrocytes drives neuroinflammation via the IL-6-STAT3 axisbioRxiv - Neuroscience 2023Quote: ... Pooled library preparations were sequenced on NextSeq® 500 whole genome sequencing (Illumina®), corresponding to 2×30million reads per sample after demultiplexing ...
-
bioRxiv - Neuroscience 2023Quote: ... Whole-genome SNP genotyping (SNP array) was conducted using Infinium OmniExpressExome-8-BeadChip (Illumina) and GenomeStudio V2.0.3 (Illumina ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The whole genome has been sequenced on a NovaSeq SP system (Illumina, 2X150 bp).
-
bioRxiv - Genomics 2023Quote: ... we conducted whole genome sequencing (WGS) on the HiSeq platform (Illumina, San Diego, CA) in a paired-end format with a read length of 150 bp ...
-
bioRxiv - Cancer Biology 2024Quote: ... Shallow whole genome sequencing (sWGS) was performed on a HiSeq4000 system (Illumina Cambridge, UK), using paired-end 150 bp protocols ...
-
bioRxiv - Immunology 2021Quote: ... DRB3/4/5 kits) for sample library preparations and ran on a Miseq sequencer (Illumina), following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Genetics 2021Quote: We converted the published set of 13,037,955 loci (derived from whole-genome short-read Illumina sequencing using Illumina HiSeq 2000 by [33] ...
-
bioRxiv - Genetics 2022Quote: ... Genomic DNA sent to Novogen (Cambridge, UK) Company Limited for whole genome sequencing (Illumina PE150). The resulting reads were aligned to the reference genome Schizosaccharomyces pombe ASM294v2 using BWA software (parameters ...
-
bioRxiv - Microbiology 2022Quote: ... Whole genome was paired-end sequenced (2 × 150 bp) in an Illumina NovaSeq6000 platform (Illumina) at Centro Nacional de Análisis Genómico (CNAG-CRG ...
-
bioRxiv - Molecular Biology 2022Quote: The whole genome sequencing of SARS-CoV-2 was performed on MiSeq System (Illumina technology), that is installed at R’VRDL ...
-
bioRxiv - Evolutionary Biology 2023Quote: We retrieved whole genome short read (WG-SR) data (100 bp paired-end Illumina sequencing) from 74 mosquito specimens for six species of the AGC from Fontaine ...
-
bioRxiv - Molecular Biology 2023Quote: ... EMS-induced SNPs in rdr1;2;6 ddm1 suppressors were identified by whole genome sequencing (Illumina Hiseq2000). Suppressors’ parental M2 seeds (rdr1 rdr2 rdr6 DDM1/ddm1 bearing the heterozygous suppressor mutation ...
-
bioRxiv - Bioengineering 2023Quote: ... whole-transcriptome sequencing was performed using a NovaSeq 6000 System (Illumina, Inc., San Diego, CA) at the Yale Center for Genome Analysis ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we estimated Ne using whole genome resequencing data (21× depth of coverage by ILLUMINA technology) for wild Central Asian ...
-
bioRxiv - Genomics 2020Quote: ... The harvested single-cell cDNA was barcoded in 96 well plate using Nextera XT Library Prep kit (Illumina). Uniquely barcoded libraries from single-cells pooled together and sequenced using a HiSeq-Hi-output-2500 sequencer (Illumina) ...
-
bioRxiv - Genomics 2019Quote: Genomic DNA (gDNA) samples from probands were analyzed with whole-genome SNP microarray (HumanOmni2.5 BeadChip, Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... The sequencing strategy is whole exome sequencing (WXS) performed with two platforms (Illumina GAIIx, Illumina HiSeq) at six centers (broad.mit.edu ...
-
bioRxiv - Genomics 2020Quote: ... The sequencing strategy is whole exome sequencing (WXS) performed with two platforms (Illumina GAIIx, Illumina HiSeq) at six centers (broad.mit.edu ...
-
bioRxiv - Microbiology 2020Quote: ... Whole genome sequencing was performed at the Oxford Genomics Centre on a HiSeq4000 platform (Illumina™), with paired-end libraries and a read length of 150 pb.
-
bioRxiv - Microbiology 2021Quote: whole genome sequencing was performed using MiSeq Illumina (36) (Illumina Inc., San Diego, CA, United states) and Nanopore MINION technologies (37) ...
-
bioRxiv - Microbiology 2021Quote: ... paired-end whole-genome Next-Generation Sequencing (NGS) was performed on a MiSeq system (Illumina, USA) with read lengths of 150 bps ...
-
Naked Mole-Rat Hematopoietic Stem and Progenitors are Highly Quiescent with an Inherent Myeloid BiasbioRxiv - Cell Biology 2021Quote: ... RNA from whole bone marrow (WBM) was sequenced with ∼230 million reads on a HiSeq2500v4 (Illumina). Raw Illumina paired-end sequencing reads where assessed with FastQC ...
-
bioRxiv - Microbiology 2019Quote: The whole procedure was performed according to the manufacturer’s protocol (Illumina, California, United States of America). One ng of fungal gDNA per specimen was used as input DNA for library preparation with NexteraXT DNA Library Prep Kit ...
-
bioRxiv - Genomics 2020Quote: Whole-genome sequencing was carried out on the Illumina NextSeq 500 platform (Illumina, San Diego, CA). We used a modified Nextera XT DNA protocol for the library preparation as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... LOH5 and LOH9 was send to Novogen (UK) Company Limited for whole genome sequencing (Illumina PE150). The resulting reads were aligned to the reference genome Schizosaccharomyces pombe ASM294v2 using bowtie2 v2.2.6 ...
-
bioRxiv - Genetics 2020Quote: ... Germline genotypes in the GTEx data had been called from whole-genome sequencing (Illumina HiSeq X) and gene expression was profiled using RNA-Sequencing (Illumina TruSeq) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... (in press) sequenced 50 fin whale (Balaenoptera physalus) whole genomes (20x coverage; Illumina HiSeqX and NovaSeq6000) from two populations ...
-
bioRxiv - Genomics 2023Quote: ... 20 transformation cycles are performed consecutively and hybrid strains are whole genome sequenced (Illumina HiSeq, Eurofins) after cycle 10 and 20 ...
-
bioRxiv - Immunology 2021Quote: ... along with number of cells loaded onto each plate was optimized for S1 and S2 100 cycle kits (Illumina) with the configuration of 67×8×50 bp ...
-
bioRxiv - Immunology 2020Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A-D (Illumina). Finally ...
-
bioRxiv - Immunology 2022Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A–D (Illumina). Finally ...
-
bioRxiv - Immunology 2022Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A–D (Illumina). Dual-barcoded libraries were pooled and sequenced using Illumina Nextseq 550 platform ...
-
bioRxiv - Cell Biology 2021Quote: ... The purified DNA was PCR amplified for 5 cycles using a Nextera DNA Library Index kit (Illumina) and Phusion HF Master Mix (New England BioLabs ...
-
Evolution and genomic signatures of spontaneous somatic mutation in Drosophila intestinal stem cellsbioRxiv - Genomics 2020Quote: ... Whole-genome 2X100 bps or 2X150 bps paired-end sequencing was performed on HiSeq2500 or Novaseq (Illumina) on a total of 34 samples and their respective head controls (Supplementary table 4) ...
-
bioRxiv - Plant Biology 2020Quote: ... and 350-bp whole-genome libraries were constructed for each accession according to the manufacturer’s specifications (Illumina). Subsequently ...
-
bioRxiv - Cancer Biology 2021Quote: ... Paired-end whole exome data was collected on the HiSeq 2000 sequencing system (Illumina, San Diego, CA). Gene expression data was collected using the Gene Chip® Human Genome U133 Plus 2.0 Array (Affymetrix ...
-
bioRxiv - Cell Biology 2022Quote: Gene expression was measured with the Illumina Mouse Whole Genome array (Illumina Inc.,San Diego,CA,USA). Sample preparations ...
-
bioRxiv - Molecular Biology 2022Quote: ... Whole exome library preparation was performed using Illumina DNA Prep with Enrichment (Illumina, San Diego, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... for whole genome sequencing on the Illumina MiSeq sequencing platform (Illumina, Inc., San Diego, CA, United States) and according to the procedures in place.
-
bioRxiv - Genetics 2023Quote: ... Whole genomic sequencing was performed using an Illumina NovaSeq 6000 Sequencing System (Illumina Inc., San Diego, USA) via an outsourcing service (Macrogen Japan Corp. ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was harvested and diluted to 0.1–0.3 ng/μl and libraries were prepared in 96-well plates using a Nextera XT DNA Sample Preparation kit (Illumina) according to the protocol supplied by Fluidigm ...
-
bioRxiv - Microbiology 2022Quote: ... Sequencing libraries were prepared using the Nextera XT DNA library preparation kit and combinations of IDT index plates (Illumina, USA). The final libraries were cleaned through AMPure SPRI bead (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were quantified using the KAPPA quantification kit following manufacturers protocol after which the plates were sequenced on the NextSeq 500 (Illumina) for 30 million reads per plate.
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were quantified using the KAPPA quantification kit following manufacturers protocol after which the plates were sequenced on the NextSeq 500 (Illumina) for 25 million reads per plate.