Labshake search
Citations for Illumina :
451 - 500 of 9636 citations for Cortisol ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... Library preparation and whole-genome sequencing using the Illumina NovaSeq 6000 device at IPK Gatersleben involved standard protocols from the manufacturer (Illumina, Inc., San Diego, CA, United States). The sequencing adapter sequences and low-quality bases were trimmed using cutadapt (v1.15)74 ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Microbiology 2019Quote: ... which was denatured and run on the MiSeq sequencer at a final concentration of 5 pM alongside a 5 pM PhiX control (Illumina). Raw reads generated by MiSeq were error-corrected and filtered using DADA2 through QIIME2 (https://qiime2.org).38 Filtered reads were clustered de novo into Operational Taxonomic Units (OTUs ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2024Quote: ... 16S rRNA PCR amplification and next-generation sequencing were performed at MR DNA (www.mrdnalab.com) using primers 515F-Y (5’-GTGCCAGCMGCCGCGGTAA-3’)73 and 806R (5’-GGACTACHVGGTWTCTAAT-3’)74 using Illumina MiSeq (Illumina Corp) 2x300 paired- end reads ...
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2019Quote: ... low call rate (> 5% low quality data [Illumina detection P>1×10−6 ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Cell Biology 2024Quote: ... spiked in with 5% PhiX Control v3 (Illumina) and sequenced on an Illumina Novaseq 6000 at a depth of ∼50,000 reads/cell with dual index ...
-
bioRxiv - Genomics 2024Quote: ... bidentatus DNA extraction and library preparation was performed by Dovetail Genomics (Scotts Valley, CA, USA) with the TruSeq DNA PCR-Free kit (Trueq Index 5, Illumina, San Diego, CA, USA, mean size 475bp). 150 bp paired-end sequencing was performed on one lane of HiSeqX by Novogene (Cambridge ...
-
bioRxiv - Developmental Biology 2024Quote: ... we prepared n=40 sequencing libraries from 1µg total RNA per sample using Illumina® Stranded mRNA Prep kits with unique 5′ and 3′ index adapter pairs (IDT for Illumina® RNA UD Indexes, Set A). Libraries were PCR amplified for 10 cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... after which the plates were sequenced on the NextSeq 500 (Illumina) for 25 million reads per plate.
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...
-
bioRxiv - Neuroscience 2020Quote: ... An additional 5 samples were sequenced on MiSeq (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... spiked with 5% PhiX pre-made library from Illumina and loaded on a Miseq v3 kit (Illumina Inc. ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Immunology 2022Quote: ... mixed with 5% PhiX and sequenced on MiSeq (Illumina) using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 5 µL Tn5 transposase (Illumina Cat FC-121-1030) and 22,5 µL nuclease-free H2O and incubated at 37 °C for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% PhiX control (Illumina, San Diego, CA, USA) along with positive (DNA sample extracted from the healthy gut ...
-
bioRxiv - Genomics 2024Quote: ... with IDT for Illumina UD Indexes (96x, Plate A, Set 1, Illumina). Library size selection was performed to remove fragments below 180 bp and above 700 bp using AMPure XP beads (Beckman coulter) ...
-
bioRxiv - Immunology 2023Quote: ... Four plates were pooled together and sequenced on a NextSeq500 instrument (Illumina) with 75 bp paired-end reads in high-output mode.
-
bioRxiv - Immunology 2021Quote: ... Genotyping of the VRC cohort and imputation of genetic variants are described in detail elsewhere.55 We interrogated 7,637,921 variants (imputed from 2,783,635 genetic variants with a minor allele frequency ≥ 5%, measured using the Illumina Human Omni 5 BeadChip array, GRCh37) for an association with each of the 166 ToxScan peptides using the penalized quasi-likelihood (PQL ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5% v/v TDE1 Tagment DNA Enzyme (Illumina, Cambridge, UK) in nuclease free water (Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 μl of NT buffer (Illumina, FC-121-1030) was added to each tube to neutralize the tagmentation reaction ...
-
bioRxiv - Genomics 2021Quote: ... 5-10% spike-in library (e.g. PhiX control from Illumina) must be added to the lane to balance the nucleotide distribution at the beginning of the forward and reversed reads ...
-
bioRxiv - Genetics 2023Quote: ... 5 μl Nextera XT V2 Index (Illumina, FC-131-2001) primer N7xx ...
-
bioRxiv - Systems Biology 2020Quote: ... Ten C1 plates were combined for analysis using the NovaSeq 6000 System (Illumina). We used SingleR to cluster by cell types per subject and we analyzed enrichment of KEGG pathways per cell type.
-
bioRxiv - Molecular Biology 2020Quote: Create CSV files listing of all 3 sets of barcodes (Illumina, plate, well)
-
bioRxiv - Microbiology 2020Quote: ... TruSeq SBS Kit v3-HS 50 cycles kit (Illumina).
-
bioRxiv - Genomics 2020Quote: Equimolar libraries from each 96 well plate were pools and sequenced with NextSeq500 (Illumina) High Output ...
-
bioRxiv - Cancer Biology 2023Quote: ... One barcoded library was prepared per plate using TD buffer and TDE1 enzyme (Illumina) for tagmentation and KAPA HiFi HotStart Ready Mix (Roche ...
-
bioRxiv - Biochemistry 2020Quote: ... the sample was spiked with 5% Phi-X control DNA (Illumina). The DNA was loaded onto the flow cell provided in the MiSeq Reagent kit v2 ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 μl of Illumina Nextera DNA unique Dual Indexes (Illumina, 20027214) plus 25 μl NEBNext High-Fidelity 2X PCR Master Mix (NEB ...
-
bioRxiv - Biophysics 2020Quote: ... The samples were spiked with 5 % Phi-X control DNA (Illumina) and loaded onto the flow cell and sequenced on and then applied onto an Illumina MiSeq instrument.
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were loaded at 6.0pM with 5% Phix control v3 (Illumina) added.
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ gene expression libraries were sequenced on a NextSeq 2000 (Illumina) aiming for 50,000 reads per cell ...
-
bioRxiv - Microbiology 2023Quote: ... Multiplexed samples were spiked with 5% PhiX Control v3 DNA (Illumina) to account for low diversity among sgRNA sequences ...
-
bioRxiv - Genomics 2023Quote: ... and 5 μl of Tagment DNA Buffer (Illumina, FC-131-1096) and incubated at 55°C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5’ gene expression libraries were sequenced on a NextSeq 2000 (Illumina), aiming for 50,000 reads per cell ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nextera XT Index Kit and Miseq Sequencing Kit (MiSeq Reagent Kits v2,300 cylce) were purchased from Illumina.
-
bioRxiv - Genomics 2022Quote: ... Tagmentation Kit (Illumina) following the Illumina reference guide instructions and recommendations ...