Labshake search
Citations for Illumina :
201 - 250 of 9522 citations for Prostaglandin E2 PGE2 Multi Format ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: RNA-seq libraries were prepared with 0,5-1 µg of total high quality RNA collected from samples and the Illumina Stranded Total RNA Prep kit (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Illumina sequencing libraries were indexed with unique 5’ and 3’ barcode combinations (up to 384 cells) using the Nextera XT DNA library preparation kit (Illumina). Libraries were pooled and size-selected with 0.9X AmpPure XP beads ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA was dephosphorylated in 3’ and then phosphorylated in 5’ to generate cDNA libraries using the NebNext Small RNA Sample Prep kit with 3’ sRNA Adapter (Illumina) according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Immunology 2021Quote: ... 1.5 ng cDNA was tagmented using 0.5 μl TruePrep Tagment Enzyme V50 and 1x TruePrep Tagment Buffer L (TruePrep DNA Library Prep Kit V2 for Illumina, Vazyme), followed by an incubation step at 55 °C for 10 min ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Purified PCR products were given unique dual indexes at the 5’ end using the Nextera XT Index Kit v2 index primers (Illumina, USA). To attach the index primers ...
-
bioRxiv - Immunology 2020Quote: ... Supernatant was discarded and nuclei were re-suspended in 50 μl reaction buffer containing 5.0 μl Tn5 transposase and 10 μl of 5 × TTBL buffer (TruePrepTM DNA Library Prep Kit V2 for Illumina, Vazyme Biotech). The reaction was incubated at 37°C for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... Samples were concentrated using a centrifugal evaporator Speed Vac® to a final volume of 5 μl and we started the TruSeq Small RNA Sample Preparation Kit (Illumina) protocol according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: Sequencing libraries were prepared from 100 ng DNA using the TruSeq Nano DNA sample preparation kit (cat# 20015964/5, Illumina Inc.) targeting an insert size of 350bp ...
-
bioRxiv - Cancer Biology 2020Quote: ... Extracted nuclei was processed for TN-5 mediated tagmentation using the Illumina Tagment DNA Enzyme and buffer kit (Nextera Illumina # 20034210) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Ribosomal RNAs were depleted from 5 μg of total RNA of the sample by Ribo-Zero rRNA Removal Kit (Seed, Root) (Illumina®). After rRNA depletion ...
-
bioRxiv - Molecular Biology 2022Quote: ... Nextera libraries (5 replicates) were constructed from 0.8 ng of pre-amplified cleaned up cDNA using Nextera XT Kit (Illumina, Eindhoven, Netherlands). Index PCR was carried out using the custom P5 primer (P5NEXTPT5 ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries were prepared from 700 ng total RNA using the TruSeq stranded mRNA library preparation kit (Cat# 20020594/5, Illumina Inc.) including polyA selection ...
-
bioRxiv - Microbiology 2023Quote: ... Amplicon libraries were mixed with 5% PhiX and sequenced with MiSeq reagent kits v2 500 cycles (Illumina, San Diego, California, USA). A blank extraction kit control ...
-
bioRxiv - Neuroscience 2023Quote: ... and a duplicate unrelated control sample was diluted to 5 ng/µl in low TE provided in AmpliSeq Library PLUS (384 Reactions) kit (Illumina, 20019103). AmpliSeq was carried out following the manufacturer’s protocol (document 1000000036408v07) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µl Tn5 (Illumina) in nuclease-free water or in 50 µl tagmentation mix “Corces et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ul TDE1 (Illumina 20034197)) and shaken at 1000 RPM for 30 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were lysed for 5 min followed by transposase reaction and library amplification using Nextera DNA Library Prep Kit (Illumina, California, USA). Libraries were then size-selected (240-360 bp ...
-
bioRxiv - Genomics 2024Quote: ... Libraries with 5% PhiX spike-in were sequenced on an Illumina NextSeq 2000 sequencer with P3 200 cycles kits (Illumina cat. #20040560) as paired-end ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Plant Biology 2024Quote: ... The subsequent steps of library preparation were all carried out on the Agilent NGS Bravo workstation in 96-well plates following the instructions for the Illumina TruSeq Stranded mRNA kit (Illumina Cat no: 20020595, Illumina, USA). mRNA was purified from 300-800 ng of total RNA through selective-binding on poly dT-coated beads ...
-
bioRxiv - Developmental Biology 2024Quote: ... and TruSeq RNA CD Index Plate (Illumina, USA) for sample multiplexing ...
-
bioRxiv - Genomics 2019Quote: ... the nuclei pellets were resuspended in transposase Master Mix (1.25 μl 10x TD buffer, 5 μl H2O and 6.5 μl of Tn5: Illumina Nextera Kit; FC-121-1031) and incubated for 30 minutes at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... indexing and amplification of the transposed DNA samples was performed by combining 10 µL of transposed DNA with the following: 5 µL of the Nextera i5 and i7 indexed amplification primers (Nextera Index Kit, Illumina, FC-121-1011), 25 μl of the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 TLX1/TLX3 and 5 HOXA) was performed using the TruSeq Stranded Total RNA (w/RiboZero Gold) sample prep kit (Illumina, RS-122-2301), involving depletion of ribosomal (rRNA ...
-
bioRxiv - Genomics 2021Quote: ... RNA-seq libraries were prepared from 500 ng total RNA using the TruSeq stranded mRNA library preparation kit (Illumina Inc, Cat# 20020594/5) including polyA selection ...
-
bioRxiv - Immunology 2020Quote: ... PCR amplification and index incorporation were performed in a 50 μl reaction containing 5 μl of forward and reverse index primers (Illumina Nextera Index Kit), 15 μl NPM ...
-
bioRxiv - Genomics 2020Quote: ... Individual cells were sequenced to a mean depth of ~1.5 million 38 bp paired-end reads on an Illumina NextSeq 500 instrument with 75 cycle high output kits (Illumina TG-160-2005).
-
bioRxiv - Microbiology 2024Quote: Total RNA of 5 μg was used to construct strand-specific RNA-sequencing libraries using the TruSeq RNA sample preparation Kit from Illumina (San Diego, CA). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... library was generated for 10 plasma exosome samples (n=5, young and old individuals each) using a propriety Illumina Truseq™ Small RNA Preparation kit (Illumina, # RS-930), according to the manufacturers’ guide ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... DNA solutions of approximately ≥5 ng μL−1 were subjected to the tagmentation reaction using the Nextera DNA Flex Library Prep Kit (Illumina, San Diego, CA) was used at 1/40 scale of the provided protocol ...
-
bioRxiv - Genetics 2022Quote: ... The flow cell was loaded with 5 picomolar pooled libraries containing 5% PhiX control V3 (Illumina). Raw sequencing data were demultiplexed with Bcl2Fastq software (v2.19 ...
-
bioRxiv - Cancer Biology 2019Quote: ... To this end shotgun libraries were generated from 5-10ng of plasma DNA using the TruSeq DNA Nano Sample Preparation Kit (Illumina, San Diego, CA, USA) as previously described[35] ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we added four mate pair libraries (3 kb, 5 kb, 7 kb, 8 kb) prepared using a Nextera Mate Pair Library Prep kit (Illumina, San Diego, CA, USA). Each library was sequenced on an Illumina HiSeq 2500 sequencer by Novogene (Sacramento ...
-
bioRxiv - Genomics 2019Quote: ... A mate pair library with an insert size of 5 kb was created with the Nextera Mate Pair Sample Prep Kit (Illumina, San Diego, CA, USA). The paired-end and mate pair libraries were sequenced on an Illumina MiSeq machine ...
-
bioRxiv - Genomics 2020Quote: Small RNA libraries were prepared starting from 5 µL DNase treated and spike-in supplemented RNA eluate using a TruSeq Small RNA Library Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol with two minor modifications(1) ...
-
bioRxiv - Immunology 2021Quote: ... The V(D)J enriched library was then constructed via Chromium Single Cell 5’ Library Construction Kit (10x Genomics Cat#1000020) and libraries were sequenced in a NovaSeq™ 6000 Sequencing System (Illumina, San Diego, CA). V(D)J sequences were collapsed using Cell Ranger ...
-
bioRxiv - Cancer Biology 2021Quote: ... Each well contained 10 μL tagmentation buffer (5 μL NIB and 5 μL TD buffer from Illumina). For the second sort plate ...
-
bioRxiv - Genomics 2020Quote: ... using the 96-well plate Nextera indexing primers (Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... using either single or dual index plates (Illumina 20028313), with a 1% PhiX control library spiked in ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Approximately 5 ug of total RNAs were used to construct cDNA libraries (NEBNext Ultra Directional RNA Library Prep Kit for Illumina, Illumina, San Diego, CA, USA). Transcriptome sequencing was performed using the Illumina Hi-Seq 2000 platform ...
-
bioRxiv - Neuroscience 2022Quote: Total RNAs from cultured mouse WT and CD38 KO astrocytes at 5 DIV were used for RNA library preparation using TruSeq Stranded mRNA Sample Preparation Kit (Illumina, Inc., San Diego, CA, USA), with polyA selection for ribosomal RNA depletion.
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...