Labshake search
Citations for Illumina :
101 - 150 of 9522 citations for Prostaglandin E2 PGE2 Multi Format ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Sequencing outputs were demultiplexed and converted to the fastq format for downstream analysis using the bcl2fastq (v2.19) conversion software (Illumina®). A total of 115,250,077 demultiplexed paired-end sequencing reads ...
-
bioRxiv - Cell Biology 2020Quote: ... The pool of libraries was loaded onto one lane of an Illumina HiSeq 4000 flow cell and sequencing was performed in a 2 × 150 bp paired end format using HiSeq 4000 SBS reagents (Illumina) and approximately 312 million acceptable quality reads were achieved ...
-
bioRxiv - Molecular Biology 2022Quote: ... Raw sequence data were obtained in Bcl-files and converted into fastq text format using the bcl2fastq program from Illumina. Mapping of transcripts was done using Genome UCSC annotation set for hg38 human genome assembly ...
-
bioRxiv - Developmental Biology 2022Quote: ... Between 59M and 130M reads were sequenced per sample in a 100bp paired-end format using a NovaSeq 6000 (Illumina) platform ...
-
bioRxiv - Microbiology 2022Quote: ... This pooled prep was subjected to PE 2x150bp format on the NextSeq2000 Illumina sequencing platform (Illumina, San Diego, CA, USA).
-
bioRxiv - Immunology 2024Quote: ... Raw sequence data were obtained in Bcl-files and converted into fastq text format using the bcl2fastq program from Illumina.
-
bioRxiv - Genomics 2023Quote: ... The pooled libraries were sequenced in the 2 × 150bp format to an average depth of 300 million reads/sample on a NovaSeq 6000 S4 (Illumina) by Psomagen Inc.
-
ATP-dependent citrate lyase Drives Left Ventricular Dysfunction by Metabolic Remodeling of the HeartbioRxiv - Molecular Biology 2024Quote: ... Raw reads from the sequencer were demultiplexed and converted to fastq format using bcl2fastq v2.19.1.403 (Illumina, Inc., San Diego, CA), optioned to allow for 0 mismatches in the barcodes.
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries were generated in 384-well format using a custom low-volume protocol based on the Nextera XT process (Illumina). The concentration of DNA from each sample was normalized to 0.18 ng/µL using a Mantis liquid handler (Formulatrix) ...
-
bioRxiv - Immunology 2021Quote: ... DNA was genotyped using the Illumina Global Screening Array v3.0+ multi disease bead chips (Illumina) and subjected to standard quality control filters ...
-
bioRxiv - Genomics 2022Quote: Multi-omics data utilized in JHS analyses including methylomics (n = 1,750, Illumina MethylationEPIC BeadChip array) [40] and proteomics (n = 2,144 ...
-
bioRxiv - Genomics 2024Quote: ... and Uruguay with available genotyped data from the Multi-Ethnic Genotyping Array (MEGA) from Illumina [30] ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 µL of transposase enzyme (Illumina Tagment DNA TDE1 kit, 20034197). We also included additional components ...
-
bioRxiv - Immunology 2019Quote: ... Basecall files (bclfiles) were demultiplexed and converted to fastQ file format using the bcl2fastq v2.18 software (Illumina Inc., San Diego, CA).
-
bioRxiv - Cell Biology 2020Quote: ... The adapter-ligated library was completed by PCR with Illumina PE primers (8-11 cycles) and the resulting directional cDNA libraries were sequenced for 50 bases in a single-read format (Illumina HiSeq2000) and analyzed with nextpresso (Graña ...
-
bioRxiv - Genomics 2020Quote: The raw data generated in binary base call (BCL) format from NovaSeq 6000 was processed using DRAGEN COVIDSeq Test Pipeline (Illumina Inc.) on the Illumina DRAGEN v3.6 Bio-IT platform as per standard protocol ...
-
bioRxiv - Genetics 2021Quote: ... including a whole-genome sequencing (WGS) data set of 1196 subjects in the VCF format and two SNP array data sets of 382 (Illumina HumanOmniExpress) and 1709 (Affymetrix GeneChip 6.0 ...
-
bioRxiv - Genomics 2023Quote: ... These BAM files were quality checked by using systemPipeR’s alignStats function and subsequently a gene reads table was calculated by the summarzieOverlaps function of the GenomicAlignments (29) R/BioConductor package and the corresponding Gene Transfer Format (GTF) file (Illumina’s iGenomes). Normalization and detection of deregulated genes was performed using the DESeq2 v ...
-
bioRxiv - Molecular Biology 2019Quote: ... the 5’ Illumina adapter (as used in the Illumina small RNA kit), a 3 nt UMI (unique molecular identifier) ...
-
bioRxiv - Molecular Biology 2019Quote: ... the 5’ Illumina adapter (as used in the Illumina small RNA kit) and a T7 promoter ...
-
bioRxiv - Cell Biology 2022Quote: ... 8 plates of mRNA libraries were sequenced using the Nextseq550 high output kit (Illumina) with 35 paired-end reads according to the manufacturer’s recommendations ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Sequencing was carried out in a 1×50bp single end format using Illumina HiSeq 4000 SBS reagents (Illumina Inc., San Diego, California, USA). Base calling was done by Illumina Real Time Analysis (RTA ...
-
bioRxiv - Microbiology 2024Quote: ... regions ITS1-ITS2 were constructed using a dual-indexing method and sequenced on a MiSeq platform with a 2x300 bp run format (Illumina, San Diego, CA) at the University of Wisconsin – Madison Biotechnology Center ...
-
bioRxiv - Microbiology 2023Quote: ... 16S rRNA gene amplicon libraries targeting the V1-V3 or V4 region were constructed using a dual-indexing method and sequenced on a MiSeq with a 2×300 bp run format (Illumina, San Diego, CA). Reagent-only negative controls were carried through the DNA extraction and sequencing process.
-
bioRxiv - Genomics 2024Quote: ... Illumina short reads of 150 base pairs (bp) in paired-end (PE) format were sequenced using the Novaseq 6000 platform (Illumina, San Diego, CA) at Novaseq Inc ...
-
bioRxiv - Microbiology 2024Quote: ... Metagenome sequencing was performed in two lanes of a NovaSeq S4 flow cell in 2×150bp paired-end format on a NovaSeq 6000 (Illumina, San Diego, USA). Raw sequencing data is available on the NCBI SRA (BioProject PRJNA974462).
-
bioRxiv - Immunology 2019Quote: ... 0.01% digitonin and 5 μl of Tn5 from the Nextera kit from Illumina, Cat ...
-
bioRxiv - Immunology 2021Quote: ... 0.01% digitonin and 5 μl of Tn5 from the Nextera kit from Illumina, Cat ...
-
bioRxiv - Genomics 2023Quote: ... the 5’ Illumina adapter (as used in the Illumina TruSeq Small RNA kit) and a split 2x 3 nt Unique Molecular Identifier (UMI ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Genetics 2022Quote: 1184 recombinant inbred lines of the S6 generation of the Global MAGIC population were genotyped from DNA extracted from leaf tissue using Genotyping-by-Sequencing (GBS, with the enzyme ApeKI) across 14 lanes of 96-sample multiplexed sequencing (100 bp single-end Illumina, Phred+33 fastq format) as reported in Zaw et al ...
-
bioRxiv - Genomics 2023Quote: A 96-well plate pre-loaded with 5 μl of 500 nM pre-indexed Tn5 transposase per well (iTSM plate, kind gift of Illumina Inc.) was used to multiplex samples and perform barcoded transposition ...
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Immunology 2020Quote: ... The enriched B cell libraries were sequenced in NextSeq or MiSeq sequencer using NextSeq Mid Output v2.5 sequencing reagent kit (read length: 2 × 150 bp) or MiSeq Reagent Kit v2 (read length: 2 × 150 bp) (Illumina) respectively.
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µg of total cellular RNA was depleted of ribosomal RNA (RiboZero kit, Illumina), and subjected to base hydrolysis ...
-
bioRxiv - Genetics 2021Quote: ... A receptacle 96 well plate was prepared with 9uL 1X TD buffer (Nextera XT Kit, Illumina Inc ...
-
bioRxiv - Neuroscience 2024Quote: ... this new plate was used for library preparation (Nextera XT kit; Illumina, Cat#: FC-131–1096) using a semi-automated pipeline ...
-
bioRxiv - Developmental Biology 2021Quote: ... multi-cell sibling and bulk parental or grandparental DNA were genotyped on BovineHD BeadChips (Illumina, San Diego, California, US). Subsequently ...
-
bioRxiv - Immunology 2021Quote: ... DRB3/4/5 kits) for sample library preparations and ran on a Miseq sequencer (Illumina), following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Genetics 2020Quote: Genotyping was attempted on 6525 DNA samples using the Multi-Ethnic Genotyping Array (MEGA)V2 (EX) consortium chip on the Infinium iSelect platform by Illumina FastTrack Services (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were processed for WGS using multi-segment PCR [10] and then prepared for deep sequencing using the Nextera XT library preparation reagent (Illumina). Samples were sequenced on the Illumina NextSeq platform ...
-
bioRxiv - Genomics 2020Quote: ... The harvested single-cell cDNA was barcoded in 96 well plate using Nextera XT Library Prep kit (Illumina). Uniquely barcoded libraries from single-cells pooled together and sequenced using a HiSeq-Hi-output-2500 sequencer (Illumina) ...
-
bioRxiv - Genomics 2022Quote: ... After purifying the Sample Tag PCR1 product indexing PCR was done following instructions of the MULTI-seq protocol where small RNA TrueSeq indexing primers (Illumina #15004197) were used for i7 and the Forward Primer from the BD WTA kit was used for i5.
-
bioRxiv - Genetics 2023Quote: ... DNA extracts from the SAC individuals were genotyped for ∼1.6 million SNPs on the Illumina Multi-ethnic genotyping array (MEGA) (Illumina, Miami, USA).
-
bioRxiv - Immunology 2021Quote: ... along with number of cells loaded onto each plate was optimized for S1 and S2 100 cycle kits (Illumina) with the configuration of 67×8×50 bp ...
-
bioRxiv - Immunology 2020Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A-D (Illumina). Finally ...
-
bioRxiv - Immunology 2022Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A–D (Illumina). Finally ...
-
bioRxiv - Immunology 2022Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A–D (Illumina). Dual-barcoded libraries were pooled and sequenced using Illumina Nextseq 550 platform ...