Labshake search
Citations for Illumina :
101 - 150 of 917 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were amplified 15 cycles while incorporating standard Nextera (Illumina) barcodes (1µL of 25 µM primer i5:i7 in 25 µL PCR reaction per well).
-
bioRxiv - Genomics 2023Quote: ... followed by adding 15 μl NPM (Illumina, FC-131-1096), 3 μl 10 μM Indexed Nextera P7 primer ...
-
bioRxiv - Systems Biology 2022Quote: ... pooled with 15% PhiX Control v3 (Illumina #FC-110-3001), and sequenced one of the following ways ...
-
bioRxiv - Immunology 2020Quote: ... Supernatant was discarded and nuclei were re-suspended in 50 μl reaction buffer containing 5.0 μl Tn5 transposase and 10 μl of 5 × TTBL buffer (TruePrepTM DNA Library Prep Kit V2 for Illumina, Vazyme Biotech). The reaction was incubated at 37°C for 30 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... After centrifugation supernatant was used for RNA cytosolic fraction by adding to 1 ml of TRIZOL and isolated nuclei of CMs were incubated in 30 µl and of EC in 10 µl transposase mixture with 5% Nextera Tagment DNA Enzyme TDE (Illumina #15027916) in transposition buffer (20 mM Tris-HCl pH 7.6 ...
-
bioRxiv - Neuroscience 2022Quote: ... DNA samples were genotyped at Estonian Genome Center using Infinium PsychArray-24 v1.1 (Illumina). Quality control (QC ...
-
bioRxiv - Genomics 2020Quote: The 79 cell lines were genotyped by Infinium HumanCore-24 v1.1 BeadChip assay (Illumina). GenomeStudioTM V2.0 (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... using Infinium HumanOmniExpress-24-v1-1-a BeadChip technology (Illumina Inc. San Diego, CA), was performed at the Cancer Genomics Research Laboratory (CGR) ...
-
bioRxiv - Cell Biology 2023Quote: ... performed on 24 cells/cell line using a NextSeq 500 (Illumina, San Diego, CA). Data analysis was performed as described previously69 ...
-
bioRxiv - Genomics 2022Quote: ... DNA from each donor was genotyped on an Infinium HumanCore-24 v1.1 BeadChip (Illumina). GenomeStudioTM V2.0 (Illumina) ...
-
bioRxiv - Systems Biology 2024Quote: ... 5’ amine-modified DNA oligonucleotides (5’-[AmC6]dUdUdUdUd-[Illumina_adaptor]-[spatial barcode]-[UMI]-[20T]-VN ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Libraries from herbarium samples were prepared with 22–157 ng of gDNA using Illumina TruSeq Nano DNA LT Sample Prep kit (Illumina, San Diego, CA, USA). They were sequenced at the GenoToul-GeT-PlaGE platform (Toulouse ...
-
bioRxiv - Genomics 2020Quote: ... Illumina sequencing was carried out via amplification of the V4 hypervariable region of the 16S rRNA gene with the Earth Microbiome modified F515/R806 primers (22) on a MiSeq platform using a MiSeq 600 cycle kit (Illumina, San Diego, CA, USA). Analysis of the V4 regions was carried out using QIIME2 (21) ...
-
bioRxiv - Genomics 2020Quote: ... 64 RNA-Seq libraries (4 time points x 4 tissues x 4 biological replicates) were prepared using the TruSeq RNA Sample Preparation Kit (Illumina). Libraries were sequenced on Illumina Nova-Seq 6000 sequencing platform at the Australian Genome Research Facility (AGRF ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... betae isolate ES-15 on the Illumina sequencing platform (Illumina, USA). Sequencing libraries were constructed with the Illumina TruSeq DNA PCR-Free kit ...
-
bioRxiv - Immunology 2023Quote: ... 16-24 million reads were obtained from each sample using a NovaSeq 6000 platform (Illumina). Reads were filtered with Trimmomatic (v0.36)(85) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The Illumina HumanCore-12 Custom BeadChip and HumanCore-24 Custom BeadChip (Illumina, San Diego, CA), were used for the genotyping ...
-
bioRxiv - Cell Biology 2024Quote: ... Nuclei were pelleted by centrifugation at 2500g for 10 min at 4°C and resuspended in 25 µL of 2x TD Buffer (Illumina Cat #FC-121-1030), containing 8 µL of Tn5 Transposes (Illumina Cat #FC-121-1030 ...
-
bioRxiv - Microbiology 2021Quote: ... The 8 pM library containing 15% PhiX control v3 (Illumina Canada, Canada) was sequenced on a MiSeq instrument (Illumina Inc ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 15 RNA-seq libraries were sequenced per lane of a HiSeq2500 (Illumina) as 100bp Single-End sequencing runs.
-
bioRxiv - Immunology 2024Quote: ... 25 µL of transposase mix (15 µL of 2x TD buffer (Illumina); 1 µL of TDE1 (Illumina) ...
-
bioRxiv - Immunology 2022Quote: Samples were genotyped on the Infinium Global Screening Array (GSA)-24 v2.0 (Illumina, San Diego, CA), with 665,608 variants genotyped per sample ...
-
bioRxiv - Genomics 2021Quote: ... Subjects were genotyped using the Illumina Infinium Global Screening Array-24 v1.0 Beadchip (Illumina, California, U.S.) following standard protocols ...
-
bioRxiv - Cancer Biology 2020Quote: Single nucleotide polymorphism (SNP) arrays were performed on the Global Screening Array-24 v2-0 (Illumina) and scanned on an iScan (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... HLA types were further confirmed with ImmunoArray-24 BeadChip v2.0 (Infinium) or HumanImmuno BeadChip v1.0 (Illumina) and HLA imputation [36] ...
-
bioRxiv - Physiology 2023Quote: All raw reads were trimmed twice (quality 0 to remove Illumina adapters, followed by quality 24) using Trimgalore! (v.0.4.0 ...
-
bioRxiv - Genomics 2024Quote: ... with ∼30,000 add-on markers from Infinium PsychArray-24 focused content panel (Illumina, San Diego, CA). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20% of the amount recommended by Illumina was used (adapters were diluted 1:10 in RSB) ...
-
bioRxiv - Plant Biology 2024Quote: ... The 20-mers were collected from Illumina and HiFi reads of ‘Fuji’ and the two parents (‘Delicious’ and ‘Ralls Janet’ ...
-
bioRxiv - Microbiology 2021Quote: ... 4) DC3000 + B (Illumina only), 5 ...
-
bioRxiv - Immunology 2021Quote: ... Group 4 (French European, Illumina), Group 5 (North American ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4 µL Nextera (Illumina). The reaction was stopped with 1% SDS and incubated at 72C for 10 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Genomics 2024Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Plant Biology 2020Quote: ... A total of 24 libraries were sequenced using the HiSeq2000 configuration 100 PE (Illumina Inc. CA, USA) at the Michigan State University Genomics core laboratory.
-
bioRxiv - Genomics 2022Quote: ... The genome integrity was assessed by a single nucleotide polymorphism-based karyotyping assay (Illumina, HumanOmniExpress-24 v1.1). The iPSCs were maintained in a defined E8 medium (Life Technologies ...
-
bioRxiv - Genetics 2023Quote: Genome-wide SNP array was performed using the Infinium Global Screening Array-24 v3.0-EA-MD (Illumina), following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... DNA was genotyped for > 650,000 markers using the Infinium Global Screening Array-24 BeadChip (v3.0 or v1.0, Illumina). Markers were mapped to hg38 or lifted over from hg19 using CrossMap (v0.6.3 ...
-
bioRxiv - Genomics 2024Quote: We genotyped the DNAs from the Tilkka participants using the Infinium Global Screening Array-24 v1 (Illumina). In our quality control (QC) ...
-
bioRxiv - Microbiology 2021Quote: ... 12-15 million sequence reads per sample were obtained on a HiSeq4000 (Illumina) with 150 bp read length.
-
bioRxiv - Cancer Biology 2021Quote: ... at 6 pM with 15% PhiX control DNA v3 (#FC-110-3001, Illumina) and sequenced on a MiSeq System (Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were pooled with 15% PhiX Sequencing Control v3 (Illumina, FC-110-3001) and 15% genomic EM-seq libraries for complexity and sequenced with 374 cycles on R1 ...
-
bioRxiv - Cell Biology 2023Quote: ... Unique index adapters were used (cat#20022371, Illumina, Inc. 15 cycles of amplification). The RNA-seq libraries were sequenced on a Novaseq 6000 Sequencing system (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Biophysics 2021Quote: ... with 20% PhiX (Illumina cat#FC-110-3001) spike-in yielding 903,488 reads.
-
bioRxiv - Immunology 2021Quote: ... Denatured libraries were diluted with 20% PhiX (Illumina) as an internal quality control and loaded onto a 600-cycle V3 MiSEQ cartridge (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Neuroscience 2021Quote: ... Genome-wide genotyping was performed using Global Screening Array 24 version 2 (Illumina, Inc., San Diego, CA, USA) at the Life & Brain facilities ...