Labshake search
Citations for Illumina :
401 - 450 of 917 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... a 4 nM library was sequenced on the Illumina Nextseq500 platform (Illumina, San Diego, CA) at the Radboudumc sequencing facility ...
-
bioRxiv - Systems Biology 2023Quote: ... allowing 4 lanes of 10x to be sequenced per NovaSeq S1 flow cell (Illumina #20028319) using a 28bp read 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... quantified and finally sequenced on Hiseq X 10 sequencer (Illumina).
-
bioRxiv - Genomics 2020Quote: ... which was sequenced on a HiSeq X-10 platform (Illumina). This yielded a total of 430 M reads ...
-
bioRxiv - Immunology 2021Quote: ... quantified and finally sequenced on Hiseq X 10 sequencer (Illumina).
-
bioRxiv - Bioengineering 2020Quote: ... quantified and finally sequenced on Hiseq X 10 sequencer (Illumina).
-
bioRxiv - Bioengineering 2020Quote: ... quantified and finally sequenced on Hiseq X 10 sequencer (Illumina).
-
bioRxiv - Genomics 2022Quote: ... along with 10% PhiX v3 library (Illumina; San Diego, CA), were pooled and clustered on a Illumina NovaSeq 6000 S2 flow cell followed by 150-bp paired-end sequencing.
-
bioRxiv - Genetics 2020Quote: ... 10 μL 2x tagmentation buffer (Illumina, Cat. FC-121-1031), and 1 μL of 8 μM loaded indexed transposase was added per well (See Picelli et al ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10× Chromium single cell libraries were sequenced by Illumina HiSeq4000 sequencer.
-
bioRxiv - Genomics 2022Quote: ... along with 10% PhiX v3 library (Illumina; San Diego, CA), were pooled and clustered on a Illumina NovaSeq 6000 S2 flow cell followed by 150-bp paired-end sequencing.
-
bioRxiv - Microbiology 2023Quote: ... along with 10% PhiX v3 library (Illumina; San Diego, CA), were pooled and clustered on a Illumina NovaSeq 6000 S2 flow cell followed by 150-bp paired-end sequencing.
-
bioRxiv - Genomics 2024Quote: ... Pooled index library 2.2nM (+10% Phix) sequenced on MiSeq (Illumina) with MiSeq v2 micro kit using paired end sequencing with 101-8-8-101 cycles ...
-
bioRxiv - Microbiology 2022Quote: ... ChIP-seq libraries were sequenced on the Illumina NextSeq 500 system with a 20% phiX spike-in (Illumina) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit).
-
bioRxiv - Synthetic Biology 2022Quote: ... normalized to 20 ng/μL and sent to Genewiz for Amplicon-EZ sequencing service (Illumina HiSeq 2×150). This service typically returns 40,000 sequences however in some cases fewer than 40,000 sequences were returned ...
-
bioRxiv - Genetics 2024Quote: ... Small RNA libraries were prepared from ∼20–45 nt total RNAs using Small RNA Library Preparation kit (Illumina) and analyzed by Illumina HiSeq 2500 platform.
-
bioRxiv - Synthetic Biology 2023Quote: The sequencing libraries were mixed with 20–30% of PhiX spike-in DNA control (Illumina #FC-110-3001) for better cluster generation on the flow cell and sequenced by Illumina MiSeq (MiSeq v3 150-cycles kit #MS-102-3001 or 300-cycles kit #MS-102-3003) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1.25 µL each of i5 and i7 indexing primers (Illumina, diluted 1:5). The samples were indexed with the following PCR cycles ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Diluted libraries were spiked with 5% Phi-X control (Illumina, San Diego, CA, USA) and sequenced using the Illumina MiSeq (Illumina Inc. ...
-
bioRxiv - Molecular Biology 2022Quote: ATAC-seq was conducted on 5×104 live cells using Nextera Tn5 transposase (Illumina) as previously described (Buenrostro et al. ...
-
bioRxiv - Immunology 2022Quote: ... 5’ expression library was sequenced with NovaSeq 6000 S1 (100 cycles) (Illumina, cat. 20012865) and the V(D)J library was sequenced with NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 U of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 μl and incubated at 25°C for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 units of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 µl and incubated at 25°C for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 µL of the Illumina PCR Primer Cocktail (PPC, Illumina FC-121-1030). PCR conditions were as follows ...
-
bioRxiv - Genetics 2020Quote: ... Pooled and denatured library (8 pM) containing 5% volume of PhiX (control library; Illumina) was sequenced using the Illumina MiSeq system with MiSeq Reagent Kit V3 (300-bp paired-end reads ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Primer Cocktail (Nextera DNA Sample Preparation Kit and Nextera Index Kit, Illumina). Amplification was performed in a Veriti 96 Well Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library amplification was performed using 5 μL Nextera XT i7 forward index primer (Illumina) and 5 μL custom i5 index primers (2 μM ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were sequenced using the llumina NextSeq 550 platform with 5% PhiX (Illumina) spike-in ...
-
bioRxiv - Immunology 2024Quote: ... Sequencing of 5’ gene expression libraries was performed on an Illumina NextSeq 2000 (Illumina) using P3 reagent kits (100 cycles) ...
-
bioRxiv - Cancer Biology 2024Quote: ATAC-seq was conducted on 5 × 104 live cells using Nextera Tn5 transposase (Illumina) as previously described 31 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and sequenced on an Illumina HiSeq 2000 sequencer (RRID:SCR_020132, v.4, Illumina, San Diego, California, USA) in 50 bp single-end mode by Genomics and Proteomics Core facility ...
-
bioRxiv - Microbiology 2022Quote: ... and diluted to 4 nM for sequencing on an Illumina MiSeq (Illumina, San Diego, CA, USA). A 500 cycle MiSeq Reagent kit v2 (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... samples were incubated in cleavage mix (MiSeq Nano kit v2 reagent 4) (Illumina MS-103-1003) for 6 min at 60 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... pH8.5) with 0.1% Tween 20 and sequenced with 100bp single end reads on Novaseq 6000 (Illumina, Inc., California, USA) according to standard protocol ...
-
bioRxiv - Microbiology 2021Quote: ... The amplicon library was diluted to 7 pM containing 20 % PhiX before sequencing on the MiSeq platform (Illumina, USA) using MiSeq reagent v3 kit to generate 300 bp paired-end reads ...
-
bioRxiv - Genomics 2021Quote: ... sex and 20 genetic principal components (derived from multidimensional scaling of genotype data from the Illumina 610-Quadv1 array).
-
bioRxiv - Developmental Biology 2024Quote: ... Pellets were resuspended in 50 µL of transposition reaction (2X TD buffer, 1X PBS, 0.1% Tween-20, 0.1% Digitonin, 5µL of Illumina Tn5 transposase) and incubated for 30 min at 37°C with 1,000 rpm agitation ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... (2022) sequenced 20 vaquita porpoise (Phocoena sinus) whole genomes from the Gulf of California to 60x coverage (Illumina HiSeqX). They mapped reads to the vaquita reference genome (mPhoSin1.pri ...
-
bioRxiv - Neuroscience 2023Quote: ... The pellet was resuspended in 200uL of Transposition Mix (1x TD buffer containing 20 U/mL Superase-In RNase Inhibitor, 40 U/mL RNasin ribonuclease inhibitor and 1.25 µl of Illumina Tagment DNA TDE1 Enzyme per every 100 000 nuclei ...
-
bioRxiv - Neuroscience 2023Quote: ... A bead ratio of 0.9x was used (20 ul of Sera-Mag Select beads to 22.10 ul library product, as per Illumina protocol), and all samples were eluted in 22 μl of Resuspension Buffer (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: The DNA libraries were diluted to 12 pM and mixed with 2.5% 20 pM PhiX and subjected to single read sequencing with a 150-cycle MiSeq Reagent Kit v3 (Illumina) on the Illumina MiSeq platform.
-
Activation of the Integrated Stress Response overcomes multidrug resistance in FBXW7-deficient cellsbioRxiv - Cancer Biology 2022Quote: ... and approximately 10 million reads were obtained per sample by Illumina sequencing ...
-
bioRxiv - Developmental Biology 2020Quote: ... or 10 minutes (H3K27ac) with 1 µl of Tn5 transposase (Illumina 15027865 ...
-
bioRxiv - Physiology 2021Quote: ... 70% ethanol wash and elution into 10 µl Elution buffer (Illumina). The RNA sample was fragmented for 4 min at 94°C in Elute ...
-
bioRxiv - Cancer Biology 2021Quote: Completed libraries were spiked with 10% commercially prepared PhiX library (Illumina) to increase base diversity for improved sequencing quality ...
-
bioRxiv - Genetics 2020Quote: ... and sequenced on an Illumina Hiseq X-10 (Illumina, Hayward, US.) with a paired-end 150 bp length configuration.
-
bioRxiv - Pathology 2021Quote: ... with the libraries clustered at 12-15pM and mixed with 5% PhiX genomic DNA (Illumina).
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...