Labshake search
Citations for Illumina :
1401 - 1450 of 9821 citations for Mouse Direct PCR Kit For Genotyping since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA was depleted from the samples with the RiboZero kit and sequencing libraries were constructed with the TruSeq kit (Illumina) for bacteria ...
-
bioRxiv - Genomics 2023Quote: ... We prepared libraries with the Nextera XT DNA Library Preparation Kit and 96-Sample Index Kit (Illumina, San Diego, CA) and quantified them using Qubit (ThermoFisher Scientific ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Ligation with Ribo-Zero Plus kit and the IDT ILMN RNA UDI B Lig 96 Idx 96 Spl index kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... mRN A purification and fragmentation and the preparation of cDNA libraries were conducted using TruSeq RNA Library Prep Kit v2 kit (Illumina). The cDNA libraries were sequenced by Illumina HiSeq-2000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Approximately 5 µg of polyA+ RNAs were used for further rRNA removal using the Ribo-Zero kit from the TruSeq Stranded Total RNA LT Kit (Illumina). Subsequently ...
-
bioRxiv - Microbiology 2024Quote: ... Total RNA was subjected to rRNA depletion to ensure ncRNA and mRNA capture using the RiboCop rRNA Depletion Kit (Lexogen) prior to strand-specific RNA-seq library preparation using the TruSeq Stranded RNA LT Kit (Illumina) with the KAPA HiFi polymerase (Kapa Biosystems ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA libraries were constructed from 1 μg/sample of total RNA using library preparation kits (NEBNext Ultra II RNA Library Prep Kit for Illumina 7770L ...
-
bioRxiv - Genomics 2022Quote: 80 to 500 ng total RNA was used as input for rRNA depletion using either Illumina’s Ribo-Zero Gold rRNA Removal Epidemiology kit (discontinued) or Illumina’s Ribo-Zero Plus rRNA depletion kit (Illumina, cat# 20037135). For Ribo-Zero Plus depletion reactions ...
-
bioRxiv - Microbiology 2023Quote: ... Ribosomal RNA was depleted using the Ribo Zero kit and samples were converted into Illumina sequencing libraries using the ScriptSeq v2 RNA-Seq Library Preparation Kit (Epicentre, Illumina). Libraries were sequenced using Illumina HiSeq (2 × 150 bp reads) ...
-
bioRxiv - Microbiology 2023Quote: ... Paired-end sequencing of the pooled libraries was performed with an Illumina MiniSeq Mid Output reagent kit and an Illumina NextSeq 500/550 High Output Kit v2.5 (Illumina, USA), configured to 2 × 150-bp cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... using a TruSeqTM Stranded Total RNA Library Prep Kit with a Ribo-ZeroTM kit and NovaSeq6000 paired-end sequencing (Illumina). The sequencing reads were aggregated into an rRNA reference (Mouse_rRNA_Reference_BK000964 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... The libraries were sequenced after onboard cluster generation using HiSeq Rapid SBS Kit v2 (200 cycles) and HiSeq PE Rapid Cluster Kit v2 (Illumina) on a HiSeq 1500 (Illumina) ...
-
bioRxiv - Physiology 2023Quote: ... using a TruSeqTM Stranded Total RNA Library Prep Kit with a Ribo-ZeroTM kit and NovaSeq6000 paired-end sequencing (Illumina). The sequencing reads were aggregated into an rRNA reference (Mouse_rRNA_Reference_BK000964 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was prepared using the manufacturers protocol (Chromium Single Cell 3’ reagent kits kit v3, 10x Genomics) and sequenced on a Novaseq 6000 instrument (Illumina). After sample processing and quality control analysis ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA was removed from the purified RNA using Ribo-Zero Gold rRNA Removal Kit accompanied by TruSeq Stranded Total RNA Kit (Illumina). RNA was then reverse-transcribed for 30[min at 50°C using ProtoScript II (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... to include ssDNA viruses) using GenomiPhi V3 DNA amplification kit (Cytiva) and sequencing library preparation using the Nextera XT kit (Illumina) was performed at previously described [43] ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was prepared for whole-genome sequencing using the Nextera Flex Library Prep Kit (now, the Illumina DNA Prep Kit) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... or viral isolates or both were sequenced on an Illumina MiSeq with up to 24 samples pooled per sequencing run by use of dual-index library preparation and the Nextera XT DNA Library Preparation kit and 300-cycle MiSeq Reagent v2 kit (Illumina). Sequence reads were trimmed for quality and mapped to respective reference sequence for each influenza A virus gene segment using Geneious Prime software (www.geneious.com ...
-
bioRxiv - Genomics 2024Quote: ... xGen Methyl-Seq Library kit was purchased from Integrated DNA Technologies and Nextera XT library prep kit was from Illumina, Inc.
-
bioRxiv - Microbiology 2024Quote: ... We extracted gDNA with the Beckman-Coulter gDNA extraction kit as above using the Nextera Flex Library Preparation Kit (Illumina). We quantitated libraries with a Qubit fluorometer (Life Technologies Corporation ...
-
bioRxiv - Cancer Biology 2024Quote: ... Purified samples were further used for library preparation with the Nextera XT DNA library preparation kit and Nextera XT index kit v2 (Illumina), according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... Plate-based RNA sample prep was performed on the PerkinElmer Sciclone NGS robotic liquid handling system using Illumina Ribo-Zero rRNA Removal Kit (Bacteria) and the TruSeq Stranded Total RNA HT sample prep kit following the protocol outlined by Illumina with the following conditions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Pooled libraries were sequenced using 2x150 bp pair-end flow cell kits for NextSeq2000 or 2x150 bp pair-end flow cell kits for MiSeq (Illumina). For more information about genomic library preparation and Influenza next-generation sequencing see Supporting information.
-
bioRxiv - Immunology 2021Quote: ... Peptides carried by the MCRs from sorted cells were amplified from cDNA by RT-PCR using the peptide flanking regions and sequenced on a miniSeq (Illumina). Sequences from the Illumina output files were trimmed ...
-
bioRxiv - Immunology 2021Quote: ... The ligated DNA was then barcoded and amplified by a limited cycle PCR and the barcoded Illumina libraries were sequenced by using paired-end 150-base protocol on a NextSeq 2000 (Illumina). Demultiplexed sequence reads were analyzed in the CLC Genomics Workbench v.21.0.3 by (i ...
-
bioRxiv - Microbiology 2019Quote: Two overlapping IN-PCR regions corresponding to the 288 amino acids of HIV-1 IN were sequenced with the MiSeq NGS platform (Illumina). The amplicons were purified with Agencourt AMPure XP (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... and amplified for 12 cycles using the SI-PCR forward primer (10x Genomics) and a Nextera i7 reverse primer (Illumina). For the HTO-containing fraction ...
-
bioRxiv - Immunology 2019Quote: ... Libraries were prepared in parallel using the same number of PCR cycles and sequenced in parallel using a 150+150 bp NextSeq (Illumina).
-
bioRxiv - Plant Biology 2019Quote: PCR amplification products of the V5–V7 region of fungal 18S and bacterial 16S rRNA genes were sequenced by Illumina MiSeq sequencer ...
-
bioRxiv - Genomics 2019Quote: ... Each sample library was uniquely barcoded and quantified by PCR using a PhiX Control v3 (Illumina, Cat #FC-110-3001) standard curve ...
-
bioRxiv - Microbiology 2019Quote: ... universal bacterial 16S rRNA genes were PCR amplified using 926F and 1392wR primers and then sequenced on an Illumina MiSeq using 30% PhiX Control v3 (Illumina) and a MiSeq Reagent Kit v3 (600 cycles ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Adaptors were added to these PCR products and then the pooled libraries were subjected to 300 cycle single-end sequencing using MiSEQ (Illumina). Data was analyzed using Geneious 9.0.5 NGS analysis tools.
-
bioRxiv - Microbiology 2019Quote: ... Paired-end sequencing (2 × 150 bp) was performed on a 300 bp PCR-free insert library on a HISeq 2500 (Illumina) at Novogene (HK ...
-
bioRxiv - Genomics 2021Quote: ... Following immunoprecipitation with Dynabeads Protein G beads (invitrogen) in PCR tubes, samples were subject to Tagmentation (5 µl Tagmentation Buffer, 1 µl Tagmentation DNA Enzyme (Illumina), 19 µl Nuclease free water ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA sequences were recovered by genomic PCR analysis and deep sequencing using MiSeq for single-end 150-bp read length (Illumina). The primer sequences used for cloning and sequencing are listed in Supplementary Table S1 ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR product mixture was sent to FASMAC to acquire 2 × 250 bp paired-end sequences using the MiSeq platform (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... High-throughput pyrosequencing of the PCR products was performed using the Illumina MiSeq platform (Illumina, Inc., San Diego, CA, USA). Paired-end reads of the original DNA fragments were excluded from the analysis if they did not well-match a 12-base Golay barcode (one or no errors) ...
-
bioRxiv - Microbiology 2021Quote: ... the sgRNA coding sequences integrated in the genomic DNA from the initial and 3-times selected populations were amplified by touch-down PCR and sequenced by Illumina deep sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... The final libraries were generated through size selection and PCR enrichment and sequenced as 2×150bp on a HiSeq2500 Sequencer (Illumina). Samples were sequenced to an approximate depth of 35–40 million reads per sample ...
-
bioRxiv - Biophysics 2022Quote: ... The extracted DNA was then amplified by PCR and attached to barcode oligonucleotides compatible with the MiSeq sequencing platform (Illumina, index1 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR-generated amplicon libraries were subjected to paired-end 2×250 Illumina MiSeq sequencing (Illumina, San Diego, CA, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... and amplified for 12 cycles using the SI-PCR forward primer (10x Genomics) and a Nextera i7 reverse primer (Illumina). For the HTO-containing fraction ...
-
bioRxiv - Cancer Biology 2022Quote: ... the ADT fraction was amplified for 10 cycles with SI-PCR oligo (10x Genomics) and TruSeq Small RNA RPI-x (Illumina) primers to index the samples ...
-
bioRxiv - Evolutionary Biology 2021Quote: We prepared the Illumina sequencing libraries by performing two consecutive rounds of PCR following the approach of Fluidigm System (Access ArrayTM System for Illumina Sequencing Systems ...
-
bioRxiv - Cancer Biology 2020Quote: ... Single cell barcoded cDNA libraries were quantified by quantitative PCR (Kappa Biosystems) and sequenced on an Illumina NextSeq 500 (Illumina). Read lengths were 26 bp for read 1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The sequencing library was generated by PCR and used to produce the clusters thereafter sequenced on NovaSeq 6000 System (Illumina). Each sample was sequenced in a separate flow cell lane ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Cancer Biology 2022Quote: ... resistant and P12 cells of cell lines #3 and #9 was performed at the Genomics and Proteomics Core Facility of the German Cancer Research Center (GPCF DKFZ, Heidelberg) using the TruSeq DNA PCR-free Methyl protocol (Illumina) for library preparation ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2019Quote: The 2nd round barcoded PCR was performed by using sixteen forward and twenty-four reverse barcoded primers obtained from Illumina MiSeq protocols (S2 Table) ...