Labshake search
Citations for Illumina :
1601 - 1650 of 9336 citations for Mouse Direct PCR Kit For Genotyping since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... with MiSeq Reagent Kit v2 (500 cycles; Illumina).
-
bioRxiv - Molecular Biology 2021Quote: ... Samples that met the Illumina TruSeq Stranded Total RNA (Human/Mouse/Rat) (Illumina Inc., San Diego, CA,USA) sample input guidelines were prepared according to the kits protocol ...
-
bioRxiv - Genomics 2022Quote: Genome-wide DNA methylation was performed using the Illumina Infinium Mouse Methylation BeadChip (Illumina, San Diego, CA, USA) following the standard manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA input was normalized to 1µg and libraries were prepared using the TruSeq Stranded mRNA Sample Prep Kit (Illumina-Kit A). Libraries were again quantified ...
-
bioRxiv - Developmental Biology 2020Quote: ... The samples were then used to generate sequencing libraries with TruSeq RNA Sample Prep Kit v2 kit (Illumina, RS-122-2001) and paired-end sequenced (2×75 ...
-
bioRxiv - Bioengineering 2022Quote: ... The amount of genomic DNA was quantified by a Qubit dsDNA HS Kit (Thermo, Q33230) and prepared for Illumina analysis using the Illumina DNA prep kit (Illumina, 20018704). Illumina sequencing of the spirulina genome was performed on a MiSeq instrument using a MiSeq Reagent Kit v2 (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adaptor and index primers were added to the sheared DNA fragments using a next-generation sequencing library preparation kit (NEBNext Ultra DNA Library Prep Kit for Illumina; NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: Library was prepared with 700ng RNA of each sample using Truseq RNA sample prep kit v2 (stranded mRNA LT kit) according to the manufacturer’s instructions (Illumina Inc., USA) 70 ...
-
bioRxiv - Genomics 2021Quote: ... Each Standard Flex library was constructed using all standard kit reagents from the Nextera DNA Flex Library Prep kit (Illumina, USA), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... sequencing of the prepared library pools was performed using MiSeq high throughput kit (v3 kit, 600 cycles) with an Illumina MiSeq platform (Illumina, USA).
-
bioRxiv - Cell Biology 2021Quote: ... Sequencing libraries were constructed from 1 ng of pre-amplified cDNA using DNA library preparation kit (TruePrep DNA Library Prep Kit V2 for Illumina, Vazyme). Libraries were sequenced on a HiSeq-PE150 ...
-
bioRxiv - Genomics 2022Quote: ... high-quality genomic DNA isolated from the young leaf samples of a short-grain aromatic rice variety Sonasal was used for constructing genomic DNA libraries using the SQK-LSK109 ligation kit (company name, country) and Illumina TruSeq DNA sample prep kit (Illumina, USA), respectively following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... The RNA-seq libraries were prepared using a TruSeq RNA Sample Preparation Kit and Multiplexing Sample Preparation Oligonucleotide Kit (Illumina, USA). The libraries were sequenced on an Illumina GAIIx (Illumina ...
-
bioRxiv - Cell Biology 2019Quote: ... All RNA samples were depleted for ribosomal RNA before library construction using Ribo-Zero™ Gold Kit H/M/R Kit (Illumina). Hi-Seq run of three independent biological replicates was performed on Illumina HiSeq2500 ...
-
bioRxiv - Microbiology 2020Quote: ... Equimolar pooled library was sequenced on an Illumina MiSeq platform using 2×300bp reagent kit (Miseq reagent kit v3; Illumina Inc.) for paired-end sequencing ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... in the DNA Sequencing Section at the Okinawa Institute of Science and Technology Graduate University using HiSeq Rapid SBS Kit v2 kit (500 cycles, Illumina, USA) yielding 250-bp paired-end reads (Fig ...
-
bioRxiv - Cancer Biology 2023Quote: ... TruSeq® Stranded Total RNA LT Library Prep Kit or TruSeq Stranded mRNA Library Prep kit (Illumina, San Diego, CA, USA) was used for preparing Strand-specific whole transcriptome sequencing libraries by following the manufacturer’s procedure ...
-
bioRxiv - Genomics 2023Quote: ... Total genomic DNA was extracted using the QIAGEN DNAeasy Plant Mini Kit and the Illumina library was prepared using a TruSeq Nano DNA Library kit (Illumina, Inc.). Libraries with an insert size of ∼550 bp were sequenced for a read length of 100 bp in paired-end mode on a HiSeq 4000 at the iGE3 sequencing platform (Geneva ...
-
bioRxiv - Cell Biology 2023Quote: ... the first strand cDNA was synthesized using TruSeq stranded total RNA kit and TruSeq stranded mRNA kit (Illumina, San Diego, USA), followed by the second strand cDNA synthesis using dUTP ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... The bisulfite-converted DNA samples were then processed for hybridization and staining using either the Illumina Infinium Human Methylation 450 BeadChip Kit or the Illumina Infinium MethylationEPIC BeadChip Kit (Illumina Inc.) according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... Single-end sequencing was performed using the library prep kit TruSeq and the sequencing kit NovaSeq6000 SP Flowcell 100 cycles (Illumina, Inc.) for Mus musculus (Ensembl.GRCm38.82) ...
-
bioRxiv - Physiology 2023Quote: ... 500 ng total RNA from each sample were used to make library according to the product guide of stranded mRNA library kit (E4720L; NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina). In short ...
-
bioRxiv - Genomics 2023Quote: ... 200ng alkylated RNA were used as input for generating 3’-end mRNA sequencing libraries using a commercially available kit (QuantSeq 3ʹ mRNA-Seq Library Prep Kit FWD for Illumina, Lexogen).
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide containing the Illumina P7 adaptor sequence was ligated to the 3’ end of the single stranded LAM PCR fragments using Circligase (Epicentre/Illumina, #CL9025K). A P5 adaptor was added by PCR ...
-
bioRxiv - Cell Biology 2020Quote: ... Libraries were then indexed and PCR amplified (10 cycles) and sequenced on Illumina HiSeq 2500 sequencing platform following the manufacture’s protocols (Illumina, Hayward CA.).Sequence reads were aligned to GRCh37-lite using Burrows-Wheeler Aligner (BWA ...
-
Evolutionary stasis of an RNA virus indicates arbovirus re-emergence triggered by accidental releasebioRxiv - Evolutionary Biology 2019Quote: ... dual indexed libraries were PCR amplified and the purified PCR products were pooled in equimolar concentrations and sequenced using 150 paired end sequencing on MiSeq or NextSeq500 sequencers (Illumina USA).
-
bioRxiv - Immunology 2020Quote: ... PCR amplicons were sequenced on an Illumina MiSeq instrument (v2 chemistry, 150 bp paired end reads) (Illumina, San Diego, CA, USA). Data were analyzed using a custom-built pipeline ...
-
bioRxiv - Plant Biology 2020Quote: ... TruSeq PCR-Free Low Throughput libraries were prepared for each DNA sample following the manufacturer’s instructions (Illumina, San Diego, CA, USA). Each sample had a unique index from Illumina TruSeq DNA CD Indexes (96 indexes/samples) ...
-
bioRxiv - Cell Biology 2022Quote: ... Purified tagmented DNA was amplified with KAPA HIFI polymerase (12 PCR cycles) and Unique Dual Primers from Illumina (Cat number 20332088). Size-selection (L:1.1 ...
-
bioRxiv - Immunology 2020Quote: ... The second round PCR (8 cycles, 70°C annealing temperature) was performed using Nextera XT index primers (Illumina, FC-131-2001) which introduce 8 base pair indices on the 5’ and 3’ termini of the amplicon for data demultiplexing of each sample screened ...
-
bioRxiv - Microbiology 2020Quote: ... PCR-generated amplicon libraries were subjected to 250 nt paired-end sequencing on a MiSeq platform (Illumina, San Diego, CA, USA).
-
bioRxiv - Evolutionary Biology 2019Quote: We assessed input gDNA quantity using Qubit and normalised the samples to 20ng/ul as described in TruSeq®DNA PCR-Free Library Prep Reference Guide (#FC-121-3001, Illumina) prior fragmentation to 350bp with Covaris S2 ...
-
bioRxiv - Genetics 2019Quote: ... Illumina sequencing adapters were added by PCR using 12 cycles of amplification (Illumina Cat. FC-131-1024 and FC-131-2001). Final sequencing libraries were purified and size selected using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2021Quote: ... A 50µl aliquot of the final pooled PCR product was sequenced at the UC Davis Genome Center DNA Technologies Core via the Illumina MiSeq PE250 platform (Illumina, CA).
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... RNA fragmentation was performed at 94°C for 6 minutes and 10 PCR cycles were used during library amplification with TruSeq single-index adapters (Illumina, #20020492). Final library concentrations were quantified with both Qubit fluorometric quantification (DNA dsDNA HS kit ...
-
bioRxiv - Genetics 2021Quote: 5× HOT FIREPol® EvaGreen® qPCR Mix Plus with ROX (Solis Biodyne) and an Eco Real-Time PCR System (Illumina) were used for qPCR ...
-
bioRxiv - Genomics 2020Quote: ... the fragmented amplicons were cleaned-up and amplified by 5 cycles of PCR using specific index adapters for Illumina sequencing (Nextera™ DNA CD Indexes, Illumina) (Supplementary Figure 1B) ...
-
bioRxiv - Immunology 2022Quote: ... The PCR product library was quantitated and subjected to sequencing on an Illumina MiSeq sequencer (Illumina, San Diego, CA 92122 USA). HLA alleles and genotypes were called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Bioengineering 2022Quote: ... The primers T7_Endo_Lib_LONG_FOR GCCCTCTGTGTGAATTCT and T7_Endo_Lib_LONG_REV GTCACCGACACAAGCTTA were used and a second round of PCR was carried out with the IDT for Illumina UD indexes (Illumina Corp.) to add adapter tags ...
-
bioRxiv - Genomics 2022Quote: ... After purifying the Sample Tag PCR1 product indexing PCR was done following instructions of the MULTI-seq protocol where small RNA TrueSeq indexing primers (Illumina #15004197) were used for i7 and the Forward Primer from the BD WTA kit was used for i5.
-
bioRxiv - Immunology 2022Quote: ... multiplex PCR was used to amplify rearranged VDJ sequences followed by high throughput sequencing using Illumina technologies (Illumina, San Diego, CA). PCR amplification bias was minimized by internal controls in the ImmunoSEQ assay29 ...
-
bioRxiv - Immunology 2022Quote: ... and PCR products were sent to the @BRIDGe platform for sequencing on an Illumina MiSeq platform (Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2022Quote: ... the index PCR step was performed as in the protocol except using IDT for Illumina DNA/RNA UD Indexes Set A (Illumina, 20027213), MyFi Mix (BIOLINE ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR-amplified libraries were quantified on a Bioanalyser and appropriately diluted and multiplexed for deep sequencing (Illumina MiSeq 2×75 bp).
-
bioRxiv - Microbiology 2023Quote: ... Equal amounts of PCR product (2 µl 4nM) were pooled and sequenced on an Illumina MiSeq Sequencer (Illumina, San Diego, USA) using a paired-end 300bp V3 kit at Utrecht Sequencing Facility (www.useq.nl).
-
bioRxiv - Systems Biology 2023Quote: ... Indexed PCR primers were synthesized by Integrated DNA Technologies using the standard 8nt indexes from Illumina (D501-D508 and D701-D712) as follows:
-
bioRxiv - Systems Biology 2023Quote: ... Indexed PCR primers were synthesized by Integrated DNA Technologies using the standard 8nt indexes from Illumina (D501-D508 and D701-D712). The sequences for the primer sets were used for the libraries cloned into pRDA-052 or pRDA-550 are listed below:
-
bioRxiv - Genetics 2022Quote: ... and hMT-2_R (GGCAGGTCAATTTCACTGGT)] and the library preparation of the LR-PCR products of hMT1 and hMT2 primers was conducted using DNA Prep Tagmentation (Illumina Inc.). This approach allows the fragment size of the tagmented LR-PCR products to be evenly 300 bp ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were then indexed and PCR amplified (10 cycles) and sequenced on Illumina HiSeq 2500 sequencing platform following the manufacture’s protocols (Illumina, Hayward CA).