Labshake search
Citations for Illumina :
1251 - 1300 of 9336 citations for Mouse Direct PCR Kit For Genotyping since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... The Nextera DNA Library Preparation Kit (Illumina) was used to perform the transposition according to the manufacturer’s manual ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... TruSeq RNA Sample Preparation Kit v2 (Illumina) was used to prepare libraries for 100 bp paired-end RNA-seq ...
-
bioRxiv - Immunology 2023Quote: ... using a NextSeq P2 sequencing kit (Illumina) with a target depth of 5 million reads per sample ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and Nextera XT Index kit v2 (Illumina) were used to produce paired-end DNA libraries using half-volume reactions ...
-
bioRxiv - Genomics 2023Quote: ... 500 cycle kit (Illumina; San Diego, CA).
-
bioRxiv - Molecular Biology 2024Quote: ... 100 cycle sequencing kit v1.5 (Illumina Inc.). Basecalling was done by Illumina RTA3 and output was demultiplexed and converted to fastq format with bcl2fastq v1.9.0.
-
bioRxiv - Microbiology 2024Quote: ... The Nextera XT library construction kit (Illumina) was used to generate sequencing libraries following the manufacturer’s recommended protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... 100-500 ng of total RNA underwent polyA selection and TruSeq library preparation according to instructions provided by Illumina (TruSeq Stranded mRNA HT Kit, Illumina #20020595), with 15 cycles of PCR ...
-
bioRxiv - Immunology 2024Quote: ... The Nextera XT Index Kit v2 (Illumina) was used to add the dual-barcoded adaptors ...
-
bioRxiv - Genomics 2020Quote: ... sgRNA libraries were generated using two-step PCR and sequenced by paired-end sequencing using a NextSeq 500 (Illumina).
-
bioRxiv - Immunology 2021Quote: ... and amplicons were used to perform the index PCR using the Nextera XT index v2 (Illumina #FC-131-1002). The index PCR products were cleaned with the Agencourt AMPure XP kit (Beckman Coulter #A63881 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Genomic DNA from these cells was used for PCR amplification of sgRNAs and sequenced using a MiSeq system (Illumina). Fold depletion or enrichment of sgRNAs from the NGS data was calculated using PinAplPy software38.
-
bioRxiv - Microbiology 2019Quote: ... The resulting PCR products were purified and loaded onto the Illumina MiSeq cartridge (Illumina Inc., San Diego, Ca, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Microbiology 2022Quote: ... The second round of PCR followed the manufacturer’s guidelines for 16S rRNA Metagenomic Sequencing Library protocol (Illumina, Cat.: 150442223) for the MiSeq system ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Neuroscience 2021Quote: ... The PCR reactions were sent to the @Bridge platform (INRAe, Jouy-en-Josas, france) for sequencing (Illumina Miseq technology). Single multiplexing was performed using home-made 6 bp index ...
-
bioRxiv - Plant Biology 2019Quote: ... RT-qPCR was performed as described previously (Nakamichi et al., 2010) using an Eco Real-Time PCR System (Illumina). Gene expression was normalized against IPP2 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Clean PCR amplicons from the same DNA sample were pooled to generate 137 libraries that were sequenced by Illumina MiSeq v3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... followed by limited PCR enrichment to generate the final cDNA sequencing library (Nextera® XT DNA Library Prep, Illumina). Libraries were sequenced as single-end 75 base pair reads on the Illumina NextSeq500 per the manufacturer’s instructions.
-
bioRxiv - Genetics 2019Quote: ... All sequencing followed the protocol in the Illumina TruSeq PCR-Free Sample Preparation Guide (Illumina cat# FC-121-2001), and used PCR-free library preparation kits purchased from KAPA Biosystems (see https://www.nhlbiwgs.org/topmed-whole-genome-sequencing-project-freeze-5b-phases-1-and-2 for additional details) ...
-
bioRxiv - Genetics 2020Quote: ... Serial PCRs were performed for targeted deep sequencing and then a MiniSeq sequencing platform (Illumina, San Diego, CA, USA) was used for next generation sequencing (NGS) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCR product was purified in a 1 % agarose gel and sequenced using a NextSeq 550 and NovaSeq (Illumina) to obtain 79+79-nt ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA synthesis was performed with 12 PCR cycles and the rest of the library preparation was performed according to the manufacturer’s instructions (10X Genomics, Illumina). All libraries were sequenced on an Illumina NovaSeq 6000 using S4 to a target sequencing depth of 100,000 reads/cell ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified DNA was amplified for library construction with PCR using Nextera i5 common adaptor and i7 index adaptors (Illumina). The final libraries were sequenced on Illumina HiSeq 4000.
-
bioRxiv - Microbiology 2022Quote: ... Paired-end sequencing (2×150 bp) and PCR-free whole genome sequencing was performed on a HiSeq X (Illumina) 54 ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were then purified and sequenced on Illumina HiSeq 2500 platform (Illumina Inc., San Diego, CA, USA) via a paired-end approach (2 × 250 bp) ...
-
bioRxiv - Genetics 2023Quote: ... PCR-enriched junctions were deep-sequenced using next-generation sequencing (NGS) technologies (Illumina MiSeq v3 single-end 150 cycles) (Figure S5).
-
bioRxiv - Cancer Biology 2024Quote: ... PCR was performed using unique dual index primer pairs (NEBNext Multiplex Oligos for Illumina from New England BioLabs, # E6440S) according the following parameters ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR products were purified and either analysed by Sanger sequencing (Mix2seq, Eurofins Genomics, Germany) or Next-Generation Sequencing (Illumina, NGSelect Amplicon ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were used for library construction and sequenced on the NovaSeq PE250 platform (Illumina, San Diego, USA) according to the protocol of Majorbio Bio-Pharm Technology Co ...
-
bioRxiv - Molecular Biology 2024Quote: ... including PCR cycles (12 cycles for cDNA amplification of 5000 cells and 14 cycles for index PCR. E13.5GE libraries from Evf2+/+and Evf2TS/TS were sequenced on the Illumina NovaSeq 6000 (Sequencing Core Facility at the La Jolla Institute).
-
bioRxiv - Genetics 2024Quote: ... according to the manufacturer’s instructions at a final primer concentration of 250 nM in Eco Real-Time PCR System (Illumina) under the following conditions ...
-
bioRxiv - Immunology 2021Quote: ... High-quality RNA was processed using an Illumina TruSeq RNA sample prep kit v2 or TruSeq Small RNA Sample Prep kit following the manufacturer’s instructions (Illumina). Clusters were generated using TruSeq Single-Read Cluster Gen ...
-
bioRxiv - Neuroscience 2020Quote: ... and sequenced on an Illumina HiSeq 2500 using HiSeq SBS kit v4 250 cycle kit (Illumina, FC-401-4003). A standard Illumina pipeline was used to generate fastq files ...
-
bioRxiv - Systems Biology 2021Quote: ... we used the KAPA RNA HyperPrep Kit with RiboErase prep combined with KAPA Unique Dual-Indexed Adapter Kit (Illumina), starting from 650 ng RNA ...
-
bioRxiv - Microbiology 2020Quote: ... and sequencing was performed using an Illumina NextSeq500 platform and NextSeq 500/550 High Output Kit v2.5 (75 Cycles) kits (Illumina). Each specimen was tested in two technical replicates ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were generated with the Chromium Single Cell ATAC Library & Gel Bead Kit (1000111) and sequenced using the NextSeq 500/550 High Output Kit v2.5 (Illumina) on an Illumina NextSeq 550 platform ...
-
bioRxiv - Plant Biology 2021Quote: ... Pre-Release Protocol Rev.A with TruSeq RNA Sample Prep Kit and TruSeq Small RNA Sample Prep Kit (Illumina Inc.). The library was reverse transcribed ...
-
bioRxiv - Physiology 2022Quote: ... Libraries were prepared according to the manufacturer’s instructions using Chromium Single Cell 3’ Library & Gel Bead Kit v2 (10X Genomics) and sequenced on the Illumina NextSeq 500 using High Output Kit v2.5 (150 cycles, Illumina) for 26 bp + 98 bp paired-end reads with 8bp single index aiming raw sequencing depth of >20,000 reads per cell for each sample.
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng RNA was prepared with a commercially available kit according to the manufacturer’s instruction (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... Georgia Institute of Technology) using the HiSeq Rapid PE Cluster Kit v2 and HiSeq Rapid SBS Kit v2 (Illumina) for 300 cycles (2 x 150 bp paired end) ...
-
bioRxiv - Genomics 2021Quote: Sequencing libraries were generated using the sequencing kit: TruSeq SBS Kit v5 – GA (36 Cycle) (FC- 104-5001, Illumina). Samples were then sequenced on an Illumina GA-IIx sequencer using paired-end (PE ...
-
bioRxiv - Immunology 2021Quote: ... or S2 Reagent Kit (100, 200, or 500 cycles) or TG NextSeq 500/550 High Output Kit v2.5 (150 cycles) (Illumina). An average of 179 million reads was generated per sample.
-
bioRxiv - Genetics 2022Quote: ... Normalised DNA libraries were clustered on Illumina cBot then sequenced using Illumina HiSeq X Ten platform using HiSeq X Ten Reagent Kit v2.5 kits (FC-501-2501, Illumina). Paired end sequencing was performed using the 2×150bp chemistry to achieve an average output of approximately >120 Gb of data per library.
-
bioRxiv - Microbiology 2023Quote: ... The sequencing libraries were built from Genomic DNA using Nextera DNA Flex Library Preparation Kit with Nextera XT Index kit based on the manufacturer’s protocols (Illumina). Libraries were quality-checked and quantified using TapeStation (Agilent Technologies ...
-
bioRxiv - Genomics 2023Quote: NGS libraries from DRIP DNA and inputs were constructed according to the manufacturer’s instructions (KAPA Hyper Prep Kit: Roche, cat. no. #KK8502 kit and single- indexed adapters from Illumina, cat ...
-
bioRxiv - Genomics 2024Quote: ... and NP0550 on either a NextSeq 550 using a NextSeq 500/550 High Output v2.5 75 cycle kit or on a NextSeq 2000 using a NextSeq 1000/2000 P3 50 cycle kit (Illumina).
-
bioRxiv - Microbiology 2024Quote: ... Libraries were sequenced with a Nextseq 2×150 pb paired-end reagent kit (NextSeq 500/550 High Output Kit v2.5, Illumina) on an Illumina Nextseq500 sequencer ...
-
bioRxiv - Cell Biology 2022Quote: Gene expression was measured with the Illumina Mouse Whole Genome array (Illumina Inc.,San Diego,CA,USA). Sample preparations ...