Labshake search
Citations for Illumina :
1151 - 1200 of 1391 citations for ssc mir 432 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... The barcode sequencing libraries were quantified by quantitative PCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824). Sequencing libraries were loaded at 18 pM on an Illumina HiSeq2500 using the following read length ...
-
bioRxiv - Genomics 2020Quote: ... Successful amplicons were screened on a 1.5% agarose gel and further purified using Agencourt AMPure XP PCR Purification kit before proceeding to Nextera XT DNA Library Preparation (Illumina), according to manufacture instructions ...
-
bioRxiv - Genomics 2020Quote: ... DNA samples were processed using the Illumina TruSeq DNA PCR-Free Sample Preparation kit (Illumina Inc., San Diego, CA, USA) on the Hamilton Microlab Star (Hamilton Robotics ...
-
bioRxiv - Genomics 2020Quote: ... Paired-end libraries were prepared by the Purdue Genomics Core Facility using the Truseq DNA PCR-Free Sample Preparation Kit (Illumina). Whole-genome sequencing was performed using Illumina short-read technology (2×100bp ...
-
bioRxiv - Immunology 2019Quote: ... Libraries were prepared in parallel using the same number of PCR cycles and sequenced in parallel using a 150+150 bp NextSeq (Illumina).
-
bioRxiv - Plant Biology 2019Quote: PCR amplification products of the V5–V7 region of fungal 18S and bacterial 16S rRNA genes were sequenced by Illumina MiSeq sequencer ...
-
bioRxiv - Immunology 2019Quote: ... and by enzymatic fragmentation of 300 pg of cDNA followed by 12 PCR cycles using the Nextera XT DNA Library Preparation Kit (cat# FC-131-1096, Illumina). Sequencing of the 15 mRNAseq libraries multiplexed together was carried out with an Illumina HiSeq2500 on a 2x125 bp paired-end run.
-
bioRxiv - Genomics 2019Quote: ... and three mate-pair libraries (insert sizes of 2 kb, 5 kb, and 8 kb) were constructed using the TruSeq PCR-free Kit (Illumina) and Mate-pair Kit (Illumina) ...
-
bioRxiv - Genomics 2019Quote: ... Each sample library was uniquely barcoded and quantified by PCR using a PhiX Control v3 (Illumina, Cat #FC-110-3001) standard curve ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Adaptors were added to these PCR products and then the pooled libraries were subjected to 300 cycle single-end sequencing using MiSEQ (Illumina). Data was analyzed using Geneious 9.0.5 NGS analysis tools.
-
bioRxiv - Microbiology 2019Quote: ... Paired-end sequencing (2 × 150 bp) was performed on a 300 bp PCR-free insert library on a HISeq 2500 (Illumina) at Novogene (HK ...
-
bioRxiv - Genomics 2019Quote: ... and ligated to TruSeq LT adapters using a TruSeq DNA PCR-Free Library Preparation Kit (Illumina, San Diego, CA, USA). We purified the ligation reaction using a Qiaquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Genomics 2021Quote: ... Following immunoprecipitation with Dynabeads Protein G beads (invitrogen) in PCR tubes, samples were subject to Tagmentation (5 µl Tagmentation Buffer, 1 µl Tagmentation DNA Enzyme (Illumina), 19 µl Nuclease free water ...
-
bioRxiv - Genomics 2021Quote: ... libraries with an insert size of 350 bp with the TruSeq DNA PCR-free gel-free library preparation kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... resequencing of genomic DNA was performed for accessions of ‘Kirakiraboshi,’ ‘Frau Yoshimi,’ ‘Posy Bouquet Grace,’ and ‘Blue Picotee Manaslu.’ Sequencing libraries (insert size of 500 bp) for the four lines were constructed with TruSeq DNA PCR-Free Library Prep Kit (Illumina) to sequence on a HiSeqX (Illumina) ...
-
bioRxiv - Genetics 2019Quote: DNA sequencing libraries were constructed from 1 µg of genomic DNA using TruSeq DNA PCR-free Library Prep kit (Illumina). Sequencing was run on an Illumina HiSeq 2500 apparatus using a paired-end read length of 2×150 pb with the Illumina Reagent Kits as already described (Demars et al ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA sequences were recovered by genomic PCR analysis and deep sequencing using MiSeq for single-end 150-bp read length (Illumina). The primer sequences used for cloning and sequencing are listed in Supplementary Table S1 ...
-
bioRxiv - Cancer Biology 2019Quote: WGS libraies were generated from 1 μg of 50 ng/ul high molecular weight gDNA using the TruSeq PCR-free Library Prep Kit (Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 ng of the resulting cDNA from 14 PCR cycles was “tagmented” and barcoded by using a Nextera XT DNA Sample Preparation Kit (Illumina). The final libraries were purified by AmPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR product mixture was sent to FASMAC to acquire 2 × 250 bp paired-end sequences using the MiSeq platform (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... High-throughput pyrosequencing of the PCR products was performed using the Illumina MiSeq platform (Illumina, Inc., San Diego, CA, USA). Paired-end reads of the original DNA fragments were excluded from the analysis if they did not well-match a 12-base Golay barcode (one or no errors) ...
-
bioRxiv - Microbiology 2021Quote: ... Metagenomic libraries were prepared using 700 ng of DNA and the TruSeq DNA PCR-Free Library Prep Kit (Illumina Inc.) following the manufacturer’s recommended protocol ...
-
bioRxiv - Microbiology 2020Quote: ... One microgram of gDNA with a DNA integrity number (DIN) of <=6 was used for library preparation using the TruSeq PCR-free library preparation kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... the sgRNA coding sequences integrated in the genomic DNA from the initial and 3-times selected populations were amplified by touch-down PCR and sequenced by Illumina deep sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... The 9 genomic DNA pools for sequencing were prepared by mixing equimolar concentrations of DNA from which 9 libraries were prepared with an insert size of 350 bp using a TruSeq PCR-free sample prep kit (Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... In the second method purified PCR amplicons (100 ng) were used to prepare sequencing libraries by TruSeq Nano DNA LT Library Preparation Kit (Illumina) with the following modifications ...
-
bioRxiv - Cell Biology 2021Quote: ... The generated cDNA was 3′ end-adenylated and ligated to Illumina Paired-end sequencing adapters and amplified by PCR using HiSeq SR Cluster Kit v4 cBot (Illumina). Libraries were analyzed on a 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Cell Biology 2021Quote: ... The final libraries were generated through size selection and PCR enrichment and sequenced as 2×150bp on a HiSeq2500 Sequencer (Illumina). Samples were sequenced to an approximate depth of 35–40 million reads per sample ...
-
bioRxiv - Genomics 2022Quote: ... The PCR products were purified with QIAquick Gel Extraction Kit and Qiagen MinElute PCR purification kits and were then sequenced on a Hiseq4000 (Illumina) with 150-bp paired-end sequencing.
-
bioRxiv - Biophysics 2022Quote: ... The extracted DNA was then amplified by PCR and attached to barcode oligonucleotides compatible with the MiSeq sequencing platform (Illumina, index1 ...
-
bioRxiv - Genomics 2022Quote: ... A library was prepared using a TruSeq DNA PCR-Free library preparation kit according to manufacturer guidance and was sequenced on a NextSeq500 instrument (Illumina) with a NextSeq High Output v2 300 cycle kit ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR-generated amplicon libraries were subjected to paired-end 2×250 Illumina MiSeq sequencing (Illumina, San Diego, CA, USA).
-
bioRxiv - Genomics 2022Quote: ... A paired-end library was prepared with the TruSeq DNA PCR-Free LT Sample Preparation Kit (Illumina, #FC-121-3001) from 1 µg of the genomic DNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... Illumina sequencing libraries were prepared from the PCR-amplified cDNA from mutant lungs and controls using the Nextra DNA library prep kit (Illumina). Libraries were sequenced on a NovaSeq 6000 S Prime flowcell (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... the ADT fraction was amplified for 10 cycles with SI-PCR oligo (10x Genomics) and TruSeq Small RNA RPI-x (Illumina) primers to index the samples ...
-
bioRxiv - Microbiology 2020Quote: Sequencing libraries were prepared for each product of long PCR (ranging from 15 to 33 kb) using the Nextera XT DNA Sample Preparation Kit (Illumina) and sequenced on the Illumina MiSeq platform to generate paired-end (PE ...
-
bioRxiv - Genomics 2019Quote: ... and then subjected to library construction using a TruSeq DNA PCR-Free HT sample prep kit (Illumina; San Diego, CA). The libraries were sequenced on a HiSeq 2500 system (Illumina ...
-
bioRxiv - Evolutionary Biology 2021Quote: We prepared the Illumina sequencing libraries by performing two consecutive rounds of PCR following the approach of Fluidigm System (Access ArrayTM System for Illumina Sequencing Systems ...
-
bioRxiv - Cancer Biology 2020Quote: ... Single cell barcoded cDNA libraries were quantified by quantitative PCR (Kappa Biosystems) and sequenced on an Illumina NextSeq 500 (Illumina). Read lengths were 26 bp for read 1 ...
-
bioRxiv - Microbiology 2021Quote: ... DNA libraries preparation with 16 cycles of PCR amplification and sequencing were done following manufacturer instructions (TruSeq ChIP-Library kit, NextSeq 500/550, Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... The sequencing library was generated by PCR and used to produce the clusters thereafter sequenced on NovaSeq 6000 System (Illumina). Each sample was sequenced in a separate flow cell lane ...
-
bioRxiv - Microbiology 2021Quote: ... Sequencing libraries were prepared from 100 ng of DNA with the TruSeq DNA PCR-Free library Prep Kit from Illumina and sequenced on Illumina MiSeq platform with 150-bp paired-end read lengths (Institut Pasteur ...
-
bioRxiv - Neuroscience 2020Quote: ... then the second-stage PCR was performed to attach Illumina i7 and i5 indexes (Illumina Nextera XT Library Preparation Kit) to individual samples ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Cancer Biology 2022Quote: ... performed the library preparation for WGS of parental and resistant cells of cell lines #3 and #9 as well as a control tail samples corresponding to line #3 with the TruSeq DNA PCR-free Kit (Illumina) and the 150 bp paired-end sequencing on a HiSeq X (Illumina).
-
bioRxiv - Cancer Biology 2022Quote: ... resistant and P12 cells of cell lines #3 and #9 was performed at the Genomics and Proteomics Core Facility of the German Cancer Research Center (GPCF DKFZ, Heidelberg) using the TruSeq DNA PCR-free Methyl protocol (Illumina) for library preparation ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were prepared from 100 ng of DNA with the TruSeq DNA PCR-Free library Prep Kit from Illumina and sequenced on Illumina MiSeq platform with 150-bp paired-end read lengths (Institut Pasteur ...
-
bioRxiv - Microbiology 2019Quote: ... using a modified PowerWater® Sterivex™ DNA Kit and from cryoconite using a PowerBiofilm™ RNA Isolation Kit (MO BIO Laboratories) prior to 16S rRNA gene and 16S rRNA (cDNA) quantitative PCR (qPCR) and V3-V4 region MiSeq (Illumina) sequencing ...
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng RNA was prepared with a commercially available kit according to the manufacturer’s instruction (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina, Lexogen). Sequencing was performed on an Illumina HiSeq2500 in 50bp single-read mode.