Labshake search
Citations for Illumina :
9851 - 9900 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Dynamic chromatin organization and regulatory interactions in human endothelial cell differentiationbioRxiv - Developmental Biology 2022Quote: ... Libraries were paired-end sequenced on a NextSeq 500 (Illumina) in a high-output run with 150 cycles ...
-
Dynamic chromatin organization and regulatory interactions in human endothelial cell differentiationbioRxiv - Developmental Biology 2022Quote: ... The libraries were paired-end sequenced using a NextSeq 500 (Illumina) in a high-output run with 150 cycles ...
-
bioRxiv - Developmental Biology 2022Quote: ... Illumina’s Nextera XT kit (Illumina, #FC-131-1096) was used with 350-400 pg cDNA as input to prepare dual-indexed Illumina RNA-sequencing libraries according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Paired-end library preparation was conducted using the TruSeq DNA PCR-free protocol (Illumina, San Diego, CA). Libraries for resequencing at low coverage (1 to 5x ...
-
bioRxiv - Microbiology 2022Quote: PCR reactions were then both combined and cleaned using 1X ratio Sample Purification Beads (Illumina) at a 1:1 bead to sample ratio ...
-
bioRxiv - Cell Biology 2022Quote: ... All libraries were sequenced on either an Illumina MiniSeq or NextSeq instrument (Illumina) using 2×150 bp kit (DNA ...
-
bioRxiv - Microbiology 2022Quote: ... and sequencing libraries prepared using the Nextera DNA Flex Prep kit (Illumina, USA) as per manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... 5’ expression library was sequenced with NovaSeq 6000 S1 (100 cycles) (Illumina, cat. 20012865) and the V(D)J library was sequenced with NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles ...
-
bioRxiv - Immunology 2022Quote: ... PCR amplicons were sequenced with MiSeq 300 cycle v2 kits (Illumina, cat. MS-102-2002). Sequences were assembled with the Defective and Intact HIV Genome Assembler 26.
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were sequenced using a custom sequencing primer (GCGACCACCGAGATCTACACACTGACTGCAGTCTGAGTCTGACAG) and the NextSeq® 500/550 Mid Output Kit v2 - 150 cycles (FC-404-2001, Illumina, CA, USA) on the Illumina NextSeq® platform.
-
bioRxiv - Immunology 2022Quote: ... PCR amplicons were sequenced with MiSeq 300 cycle v2 kits (Illumina, cat. MS-102-2002). Sequences were assembled with the Defective and Intact HIV Genome Assembler 26.
-
bioRxiv - Immunology 2022Quote: ... and the V(D)J library was sequenced with NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles) (Illumina, cat. 20024905).
-
bioRxiv - Genetics 2022Quote: ... and quantified using Kapa (Illumina). For samples prepared using ‘The Single Cell 3’ Reagent Kit v2’ ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transposition was performed directly on nuclei using 25 µl tagmentation reaction mix (Tagment DNA Buffer #15027866, Tagment DNA Enzyme #15027865 from Illumina Tagment DNA kit #20034210). Tagged DNA was subjected to PCR amplification and library indexing ...
-
bioRxiv - Developmental Biology 2022Quote: ... with Nextera DNA CD Indexes (Illumina #20015882), according to the following program ...
-
bioRxiv - Genetics 2022Quote: ... then pooled them and sequenced the 2×75 bp paired-end libraries on one Flowcell of an Illumina NextSeq 550 with a High Output v2 kit (150 cycles) (Illumina Inc., San Diego, California, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing of the constructed libraries was performed on a HiSeq 4000 system (Illumina), and the raw fastq data were analyzed using the CCBR/Pipeliner (33) ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA libraries (COR-L279) and mRNA libraries (H446 and LX22) were constructed using a TruSeq Stranded Total RNA Kit (Illumina, RS-122-2201) and an mRNA Library Prep kit V2 (Illumina ...
-
bioRxiv - Genomics 2022Quote: We did not analyze raw RNA-seq data (i.e., Illumina sequence reads) for two of the infection datasets ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were prepared with TruSeq RNA Library Prep Kit v2 (Illumina) and 75c single-end sequencing in an Illumina NextSeq 550 sequencer ...
-
bioRxiv - Microbiology 2022Quote: ... Microbial community sequencing on an Illumina MiSeq using 2 × 250 bp libraries (Illumina, San Diego, California) was completed in 4 batches ...
-
bioRxiv - Genomics 2022Quote: Meta 16S short-read information of the V3V4 region was acquired from each environmental sample by Illumina MiSeq 300 cycle paired-end sequencing ...
-
bioRxiv - Developmental Biology 2022Quote: ... the ribosomal RNA fraction was removed from 1μg of total RNA using the Ribo-Zero(tm) Gold Kit (Illumina). Fragmentation was then achieved using divalent cations under elevated temperature to obtain approximately 300bp pieces ...
-
bioRxiv - Genomics 2022Quote: ... We constructed RNA-Seq libraries with the RiboZero rRNA Removal Kit (Illumina), checked their quality with the BioAnalyzer DNA 1000 assay (Agilent) ...
-
bioRxiv - Genomics 2022Quote: ... Then 16S rRNA gene sequencing libraries were prepared according to Illumina’s protocol and run on an Illumina MiSeq for 300 cycles of paired-end sequencing using a MiSeq v3 600-cycle reagent kit (Illumina, San Diego, CA, USA). For S1 ...
-
bioRxiv - Microbiology 2022Quote: ... Quality control and adapter trimming was performed with bcl2fastq (Illumina) and porechop (https://github.com/rrwick/Porechop ...
-
bioRxiv - Microbiology 2022Quote: ... and ten were constructed using TruSeq RNA Library Prep Kit (Illumina, USA) according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: ... library preparation (TruSeq Stranded TotalRNA, Illumina), sequencing (2x 100 bp ...
-
bioRxiv - Cancer Biology 2022Quote: ... and an mRNA Library Prep kit V2 (Illumina, RS-122-2001), respectively ...
-
bioRxiv - Neuroscience 2022Quote: ... NextSeq 500/550 High Output kit 75 cycles (Illumina #200024906) were processed at the Genomics and Bioinformatics Core Facility (Institute of Molecular Genetics CAS ...
-
bioRxiv - Neuroscience 2022Quote: ... Using cutadapt v1.18101, the number of reads (minimum, 32 million; maximum, 73 million) was trimmed by Illumina sequencing adaptor and of bases with reading quality lower than 20 ...
-
bioRxiv - Genomics 2022Quote: ... We used a Nextera XT DNA sample prep kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Single-end sequencing was performed on an Illumina NextSeq 500 (Illumina, San Diego, CA, USA) with 150 cycles at the Institute of Biotechnology ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The Norwegian Sequencing Centre (www.sequencing.uio.no) prepared the libraries using the TruSeq protocol for stranded mRNA (Illumina, San Diego, USA) and performed the sequencing ...
-
HNRNPA2B1 controls an unfolded protein response-related prognostic gene signature in prostate cancerbioRxiv - Cancer Biology 2022Quote: ... Libraries were generated using the TruSeq RNA Library Prep Kit v2 (RS-122-2001, Illumina) and 75bp paired end sequencing performed to 30M read depth using the NextSeq 500 (Illumina) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Multiplexes were then sequenced on individual lanes on a HiSeq2000 (Illumina) using V4 50 cycle single read kit generating approximately 500.000 reads per cell.
-
bioRxiv - Genomics 2022Quote: ... A total of five samples (three biological replicates for each of five samples) were sequenced to generate paired-end reads using an Illumina HiSeqTM 2000 platform (Illumina Inc., San Diego, CA, USA) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... Cells were prepared for SORT-seq as previously described.23 Illumina sequencing libraries were then prepared with the TruSeq small RNA primers (Illumina) and sequenced single-end at 75 bp read length with 75.000 reads per cell on a NextSeq500 platform (Illumina) ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... 19bp single end sequencing (Illumina-C HiSeq 2500).
-
bioRxiv - Cancer Biology 2022Quote: ... DNA libraries were prepared using TruSeq ChIP sample prep kit (Illumina) and sequenced on a NextSeq 550 (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... and libraries were generated using the TruSeq Stranded mRNA Library kit (Illumina). Paired end sequencing was performed on an Illumina NextSeq2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... Sequencing was performed on a NextSeq 500/550 sequencer (Illumina). Raw sequencing data were processed using the cellranger-6.0.0 pipeline ...
-
bioRxiv - Cell Biology 2022Quote: ... were sequenced on a NextSeq 500 (Illumina) with High output Kit v2.5 (150 cycles ...
-
bioRxiv - Cell Biology 2022Quote: ... Libraries were generated with TruSeq Stranded mRNA Library Preparation kit (Illumina) from high quality total RNA samples according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tagmentation was performed using the Nextera XT DNA library preparation kit (Illumina) and a mosquito liquid handler (SPT Labtech) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Sequencing was performed on the Illumina HiSeq 4000 paired end at 2 X126 bp or single end 126 bp using the TruSeq SBS Kit v4-HS (Illumina, Inc, California, USA).
-
bioRxiv - Molecular Biology 2022Quote: ... were resuspended in 50 μl transposase mixture (25 μl Illumina TD buffer, 22.5 μl H2O, and 2.5 μl Illumina TDE1 transposase) and incubated at 37°C for 30 min with shaking at 1,000 rpm ...
-
bioRxiv - Molecular Biology 2022Quote: ... or purified chromosomes (2 x 106 pelleted at 10,000g for 10min at 4°C) were resuspended in 50 μl transposase mixture (25 μl Illumina TD buffer ...
-
bioRxiv - Molecular Biology 2022Quote: Adaptor oligonucleotides were synthesized by IDT (Supplementary Table S4).37,38 Transposon assembly was done by incubating 158 μg Tn5 with 1.4 nmol annealed oligo (contains the full-length Illumina forward (i5) adapter ...