Labshake search
Citations for Illumina :
9801 - 9850 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... quantified and then pooled before sequencing on a Hiseq4000 (Illumina) in collaboration with the Biomedical Sequencing Facility (BSF ...
-
bioRxiv - Cell Biology 2022Quote: ... Sequencing was performed by the CCHMC DNA Sequencing core using the NovaSeq 6000 (Illumina) sequencing platform with an S4 flow cell to obtain approximately 320 million reads per sample ...
-
bioRxiv - Cancer Biology 2022Quote: ... The gene expression data were generated from Illumina HiSeq 2000 RNA Sequencing platform and were mentioned in terms of log2(RPKM+1) ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequences of the DNAs were analyzed using the NovaSeq6000 platform (Illumina) at Macrogen (Japan) ...
-
bioRxiv - Genomics 2022Quote: ... and then sequenced using a HiSeq3000 system (Illumina Inc) with a read setup of 2×151 bp.
-
bioRxiv - Genomics 2022Quote: ... were sent to BGI-Shenzhen (Shenzhen, China) for library construction and sequencing on the using Illumina Genome Analyzer IIx (GAIIx) platform (Illumina Inc., San Diego, CA, USA) to generate single-end reads.
-
bioRxiv - Genomics 2022Quote: ... The DNA sample was sent to BGI Shenzhen (Shenzhen, China) for library construction and de novo sequencing on the Illumina HiSeq2000 and HiSeq2500 platform (Illumina Inc., San Diego, CA, USA) and the PacBio RS II platform (PacBio Inc. ...
-
bioRxiv - Genomics 2022Quote: ... Genome-wide single nucleotide polymorphism (SNP) genotyping was performed using Illumina OmniExpress Genotyping BeadChips according to the manufacturer’s protocols (Illumina, Inc., San Diego, California, USA). Prior to association analysis ...
-
bioRxiv - Bioengineering 2022Quote: ... Samples were sequenced on a HiSeq2500 HighOutput (Illumina) with a 5% spike-in of PhiX.
-
bioRxiv - Developmental Biology 2022Quote: ... The resulting cDNAs were converted to libraries using a Nextera XT kit (Illumina, USA), with a modified protocol according to SMART-Seq v4 user manual ...
-
bioRxiv - Developmental Biology 2022Quote: ... These libraries were pooled and sequenced using a NextSeq 550 instrument (Illumina, USA) with a MidOutput cartridge at 2x75 cycles ...
-
bioRxiv - Genetics 2022Quote: ... Libraries were sequenced on a NextSeq 550 instrument (Illumina). Depending on the number of samples ...
-
bioRxiv - Genetics 2022Quote: ... We used the Nextera DNA library kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Genetics 2022Quote: ... cleaned library passed all three QC assays and was sequenced on a Next-Seq 2000 instrument (Illumina) in paired-end mode with 150 bp reads ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were processed on the Illumina HiSeq 550 sequencing system with the NextSeq 500/550 High Output kit v2.5 (Illumina, Cat. No. 20024906). The generated fastq files were loaded into the DolphinNext platform (https://dolphinnext.umassmed.edu/ ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Nextera XT libraries were generated and sequenced in three different runs on MiSeq 2×300bp paired (Illumina, San Diego, CA, USA), as recommended by the manufacturer ...
-
bioRxiv - Developmental Biology 2022Quote: ... Library preparation was performed using the TruSeq cDNA library construction (Illumina). Samples were processed on the Illumina HiSeq 550 sequencing system with the NextSeq 500/550 High Output kit v2.5 (Illumina ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Sequencing libraries were prepared using the TruSeq Nano kit (Illumina, San Diego, CA, USA) and sequenced on the MiSeq platform ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... High-throughput genome sequencing was performed either on Hiseq 2000 (2 × 100 or 2 × 150 paired-end reads) or Miseq (2 × 300 paired-end reads) sequencer (Illumina, San Diego, CA) following the manufacturer ‘s instruction.
-
bioRxiv - Evolutionary Biology 2022Quote: ... High-throughput genome sequencing was performed using a HiSeq 2500 machine (Illumina, San Diego, CA, USA).
-
bioRxiv - Plant Biology 2022Quote: ... RNA-Seq libraries were prepared with TruSeq RNA Library Preparation Kit v2 (Illumina, USA), followed by pair-end sequencing on HiSeq 2500 sequencer (Illumina) ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by pair-end sequencing on HiSeq 2500 sequencer (Illumina). Reads were filtered using TRIMMOMATIC (ver 0.36 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were sequenced on a HiSeq2500 (Illumina) using SE 100BP sequencing.
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were prepared using a TruSeq library prep kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were sequenced on a HiSeq2500 or HiSeq-X (Illumina) using 100 BP PE sequencing.
-
bioRxiv - Systems Biology 2022Quote: ... Libraries were prepared with the TruSeq Nano DNA HT sample prep kit (Illumina) and 2 x 151 bp sequenced on the Illumina HiSeq 4000 platform ...
-
bioRxiv - Physiology 2022Quote: ... high-sensitivity spectrofluorometric measurement was poly-A selected and reverse transcribed using Illumina’s TruSeq stranded mRNA library preparation kit (Cat# 20020595; Illumina, San Diego, CA). Each sample was fitted with one of 96 adapters containing a different 8 base molecular barcode for high level multiplexing ...
-
bioRxiv - Genomics 2022Quote: ... Next generation sequencing libraries were prepared with the TruSeq Stranded mRNA Sample Preparation kit (Illumina) from 350 ng of input RNA using IDT for Illumina TruSeq UD Indexes (IDT) ...
-
bioRxiv - Biochemistry 2022Quote: ... Libraries were sequenced using a NextSeq 500 Mid Output 150-cycle kit (Illumina, San Diego, CA) at an average depth of ~2 million reads per quartile.
-
bioRxiv - Neuroscience 2022Quote: Total RNAseq libraries were prepared from 1 microgram of total RNA from frozen brain tissue using the TruSeq Stranded Total RNA with Ribo-Zero Gold kit (Illumina) according to the protocol specifications ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were sequenced on a HiSeq 2000 and/or HiSeq2500 on a 1×50 bp single read (SR) flow cell (Illumina) at an average of 20M reads/sample ...
-
bioRxiv - Genomics 2022Quote: ... and NovaSeq 6000 S4 Reagent Kit v1.5 (200 cycles) or NovaSeq 6000 S4 Reagent Kit v1.0 (100 cycles) (Illumina) following manufacturer instructions ...
-
bioRxiv - Genomics 2022Quote: ... Sequencing was performed by Illumina Novaseq 6000 sequencer (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... and 12% PhiX control library v3 (Illumina) was spiked into the library ...
-
bioRxiv - Immunology 2022Quote: ... RNA-seq libraries were prepared using the TruSeq RNA sample preparation kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... Libraries for resequencing at low coverage (1 to 5x) were produced with an average insert size of 350 bp and sequenced on a HiSeq 4000 instrument (Illumina). Libraries for resequencing at high coverage (15 or 30x ...
-
bioRxiv - Microbiology 2022Quote: ... Genomic libraries were prepared using the Nextera XT DNA Library Preparation Kit (Illumina, San Diego, CA) and genomes were sequenced as paired-end (2 × 150-bp ...
-
bioRxiv - Genomics 2022Quote: ... Libraries for resequencing at high coverage (15 or 30x) were produced with an average insert size of 550 bp and sequenced on a HiSeq X instrument (Illumina). All libraries were sequenced at Edinburgh Genomics (Edinburgh Genomics ...
-
bioRxiv - Cancer Biology 2022Quote: ... an equal combination of additional PCR products containing two inverse barcodes (GACTCAGTGTCAGACTGAGTGTCTGACTGT and CTGAGTCACAGTCTGACTCACAGACTGACA) plus the PhiX Control V3 (Cat. FC-110-3001, Illumina, CA, USA) were spiked in to balance the nucleotide distribution within the library ...
-
bioRxiv - Microbiology 2022Quote: ... The final pooled library was sequenced an Illumina MiSeq using a V3 flowcell and 600 cycle kit (Illumina).
-
bioRxiv - Physiology 2022Quote: ... Paired-end 100-bp sequenced reads were analyzed as follows: RTA (Illumina) software was used for base calling and bcl2fastq2 (version 2.19 ...
-
bioRxiv - Developmental Biology 2022Quote: RNA-seq libraries were sequenced by Illumina NextSeq500 at a median sequencing depth of 58,585 reads per single cell ...
-
bioRxiv - Developmental Biology 2022Quote: ... poly(A)-selected RNA-seq libraries were prepared by Novogene Co. using the NEBNext UltraII RNA library prep kit for Illumina (cat. #E7775) and sequenced on a NovaSeq6000 (Illumina) to produce paired-end 150-bp reads (average 40.4 million reads per sample) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 500 ng of RNA was used for library prep with TruSeq mRNA library prep kit (Illumina) and sequenced using Next Seq 500 Sequencing (epi,neur ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and cDNA sequencing library was prepared using the TruSeq Stranded mRNA Library Prep Kit (Illumina), following the manufacturer’s guidelines ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... rRNA was removed with Ribo-Zero Plus kit (Illumina Inc.), and cDNA sequencing library was prepared using the TruSeq Stranded mRNA Library Prep Kit (Illumina) ...
-
Dynamic chromatin organization and regulatory interactions in human endothelial cell differentiationbioRxiv - Developmental Biology 2022Quote: ... RNA-seq libraries were prepared from total RNA (≥200 nucleotides in length) using the TruSeq Stranded Total RNA Ribo-Zero H/M/R kit (Illumina, RS-122-2201). Libraries were paired-end sequenced on a NextSeq 500 (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... and sequencing (NovaSeq, Illumina) were performed per protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... The following pair-end sequencing was performed on a MiSeq system (Illumina; San Diego – USA) using the Illumina MiSeq reagent Kit v2 (500 cycles-2×250 paired end ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were then sequenced in paired-end 150 bp mode on a NovaSeq 6000 system (Illumina, San Diego, CA). The frames around the capture area on the Visium slide were aligned manually ...